\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801877570:

Variant ID: vg0801877570 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1877570
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCTGCTTCCCTCTCCATGGCTCCACGACCAGGAAGGGCGCCGTCTTCCTGAAGCTCCTTCAGCGATGCGCTGGTGGAAGATGACTTGCCGAGGTCCAT[C/T]
GCTGATCGAAGATCGCCGGTGAAAGGACCTAAGTTGCTGAACTAGGGTTTTTGCGGGAGTGGAGAAGACGAGAGGCGCTTGGGGGCTGGAGAATTTTTCC

Reverse complement sequence

GGAAAAATTCTCCAGCCCCCAAGCGCCTCTCGTCTTCTCCACTCCCGCAAAAACCCTAGTTCAGCAACTTAGGTCCTTTCACCGGCGATCTTCGATCAGC[G/A]
ATGGACCTCGGCAAGTCATCTTCCACCAGCGCATCGCTGAAGGAGCTTCAGGAAGACGGCGCCCTTCCTGGTCGTGGAGCCATGGAGAGGGAAGCAGGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 23.40% 0.19% 11.68% NA
All Indica  2759 74.70% 5.30% 0.33% 19.64% NA
All Japonica  1512 42.10% 57.70% 0.00% 0.20% NA
Aus  269 81.40% 18.20% 0.00% 0.37% NA
Indica I  595 70.80% 2.40% 0.17% 26.72% NA
Indica II  465 82.40% 6.50% 0.00% 11.18% NA
Indica III  913 75.10% 4.60% 0.66% 19.61% NA
Indica Intermediate  786 72.60% 7.80% 0.25% 19.34% NA
Temperate Japonica  767 4.40% 95.40% 0.00% 0.13% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.10% 0.00% 0.83% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 65.60% 27.80% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801877570 C -> T LOC_Os08g03940.1 upstream_gene_variant ; 1.0bp to feature; MODIFIER silent_mutation Average:61.714; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0801877570 C -> T LOC_Os08g03930.1 downstream_gene_variant ; 3960.0bp to feature; MODIFIER silent_mutation Average:61.714; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0801877570 C -> T LOC_Os08g03940-LOC_Os08g03950 intergenic_region ; MODIFIER silent_mutation Average:61.714; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0801877570 C -> DEL N N silent_mutation Average:61.714; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801877570 NA 1.73E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 1.28E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 7.33E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 2.88E-06 NA mr1551 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 1.65E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 9.38E-09 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 1.93E-15 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 2.61E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 9.35E-08 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 1.32E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 2.18E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 2.20E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 4.40E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 2.56E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 9.92E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 3.99E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 7.36E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 2.47E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 1.09E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877570 NA 1.49E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251