Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801877389:

Variant ID: vg0801877389 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1877389
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCTCGCAAAGATGAGCAAAGATGCTAAGAAAGGCAATAGAATTGGGGTTCAAATGAAGAAGAGAAAGACCATAGAAGTTCAAAATCAGGAGGAGAAATT[C/A]
GGAAGGCGGAGGGAGAAAACCGCAGAGAACATAGTCTTCGATCGCAACCATGCGACCTAAGACGGGCTGGGGATTAGTACCTCCTGCTTCCCTCTCCATG

Reverse complement sequence

CATGGAGAGGGAAGCAGGAGGTACTAATCCCCAGCCCGTCTTAGGTCGCATGGTTGCGATCGAAGACTATGTTCTCTGCGGTTTTCTCCCTCCGCCTTCC[G/T]
AATTTCTCCTCCTGATTTTGAACTTCTATGGTCTTTCTCTTCTTCATTTGAACCCCAATTCTATTGCCTTTCTTAGCATCTTTGCTCATCTTTGCGAGGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.00%	22.20%	0.08%	11.81%	NA
All Indica	2759	75.10%	4.90%	0.14%	19.86%	NA
All Japonica	1512	42.10%	57.70%	0.00%	0.20%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	70.80%	2.20%	0.00%	27.06%	NA
Indica II	465	81.90%	7.10%	0.00%	10.97%	NA
Indica III	913	75.50%	4.30%	0.44%	19.82%	NA
Indica Intermediate	786	73.90%	6.40%	0.00%	19.72%	NA
Temperate Japonica	767	4.40%	95.40%	0.00%	0.13%	NA
Tropical Japonica	504	89.50%	10.50%	0.00%	0.00%	NA
Japonica Intermediate	241	63.10%	36.10%	0.00%	0.83%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	65.60%	27.80%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801877389	C -> A	LOC_Os08g03930.1	downstream_gene_variant ; 3779.0bp to feature; MODIFIER	silent_mutation	Average:55.288; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N
vg0801877389	C -> A	LOC_Os08g03940.1	intron_variant ; MODIFIER	silent_mutation	Average:55.288; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N
vg0801877389	C -> DEL	N	N	silent_mutation	Average:55.288; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801877389	NA	1.73E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	1.28E-07	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	7.33E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	1.65E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	9.38E-09	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	2.97E-14	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	1.93E-15	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	2.53E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	2.61E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	9.35E-08	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	1.32E-07	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	3.15E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	2.18E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	2.20E-10	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	4.40E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	2.56E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	9.92E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	5.29E-06	5.29E-06	mr1524_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	1.39E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	3.99E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	7.06E-13	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	1.84E-06	6.30E-08	mr1663_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	3.12E-06	3.12E-06	mr1663_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	7.43E-06	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	3.95E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	2.47E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	6.64E-10	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801877389	NA	1.49E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251