\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801871198:

Variant ID: vg0801871198 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1871198
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.36, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCCTCTTCCTCGAATAGATCAACTGGTGGACTCGACAGCCGGCTGTGAACTGTTGAGCTTTCTCGACGCTTACTCCGGCTATCACCAAATTAGCATGG[T/C]
GAAAGAGAACGAAGAGAAGACAGCATTCATCACGCCGTTCGGGGTATTTTGCTACGTTAAGATGCCTTTCGGACTGATAACAGCAGGGAATACTTTCCAG

Reverse complement sequence

CTGGAAAGTATTCCCTGCTGTTATCAGTCCGAAAGGCATCTTAACGTAGCAAAATACCCCGAACGGCGTGATGAATGCTGTCTTCTCTTCGTTCTCTTTC[A/G]
CCATGCTAATTTGGTGATAGCCGGAGTAAGCGTCGAGAAAGCTCAACAGTTCACAGCCGGCTGTCGAGTCCACCAGTTGATCTATTCGAGGAAGAGGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 25.20% 3.07% 9.04% NA
All Indica  2759 69.30% 10.50% 5.11% 15.11% NA
All Japonica  1512 42.30% 57.50% 0.13% 0.13% NA
Aus  269 98.90% 0.40% 0.37% 0.37% NA
Indica I  595 69.20% 3.90% 4.71% 22.18% NA
Indica II  465 78.90% 8.40% 3.23% 9.46% NA
Indica III  913 63.70% 15.80% 6.13% 14.35% NA
Indica Intermediate  786 70.10% 10.60% 5.34% 13.99% NA
Temperate Japonica  767 4.40% 95.30% 0.13% 0.13% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 63.90% 35.30% 0.41% 0.41% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 67.80% 23.30% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801871198 T -> C LOC_Os08g03930.1 missense_variant ; p.Val1020Ala; MODERATE nonsynonymous_codon ; V1020A Average:44.033; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 benign -0.791 TOLERATED 1.00
vg0801871198 T -> DEL LOC_Os08g03930.1 N frameshift_variant Average:44.033; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801871198 NA 2.28E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.46E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 4.08E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 3.11E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 4.56E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 3.97E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.14E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.39E-11 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 7.55E-16 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.09E-12 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.57E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 2.23E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.11E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 9.20E-06 mr1216_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.09E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.94E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 4.56E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 7.77E-06 mr1483_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 5.34E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 3.10E-06 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 3.20E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.78E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 5.85E-06 1.24E-06 mr1928_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 2.34E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198 NA 1.99E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251