Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801871198:

Variant ID: vg0801871198 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1871198
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.36, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCCTCTTCCTCGAATAGATCAACTGGTGGACTCGACAGCCGGCTGTGAACTGTTGAGCTTTCTCGACGCTTACTCCGGCTATCACCAAATTAGCATGG[T/C]
GAAAGAGAACGAAGAGAAGACAGCATTCATCACGCCGTTCGGGGTATTTTGCTACGTTAAGATGCCTTTCGGACTGATAACAGCAGGGAATACTTTCCAG

Reverse complement sequence

CTGGAAAGTATTCCCTGCTGTTATCAGTCCGAAAGGCATCTTAACGTAGCAAAATACCCCGAACGGCGTGATGAATGCTGTCTTCTCTTCGTTCTCTTTC[A/G]
CCATGCTAATTTGGTGATAGCCGGAGTAAGCGTCGAGAAAGCTCAACAGTTCACAGCCGGCTGTCGAGTCCACCAGTTGATCTATTCGAGGAAGAGGGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	25.20%	3.07%	9.04%	NA
All Indica	2759	69.30%	10.50%	5.11%	15.11%	NA
All Japonica	1512	42.30%	57.50%	0.13%	0.13%	NA
Aus	269	98.90%	0.40%	0.37%	0.37%	NA
Indica I	595	69.20%	3.90%	4.71%	22.18%	NA
Indica II	465	78.90%	8.40%	3.23%	9.46%	NA
Indica III	913	63.70%	15.80%	6.13%	14.35%	NA
Indica Intermediate	786	70.10%	10.60%	5.34%	13.99%	NA
Temperate Japonica	767	4.40%	95.30%	0.13%	0.13%	NA
Tropical Japonica	504	89.50%	10.50%	0.00%	0.00%	NA
Japonica Intermediate	241	63.90%	35.30%	0.41%	0.41%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	67.80%	23.30%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801871198	T -> C	LOC_Os08g03930.1	missense_variant ; p.Val1020Ala; MODERATE	nonsynonymous_codon ; V1020A	Average:44.033; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	benign	-0.791	TOLERATED	1.00
vg0801871198	T -> DEL	LOC_Os08g03930.1	N	frameshift_variant	Average:44.033; most accessible tissue: Zhenshan97 flag leaf, score: 62.519	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801871198	NA	2.28E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.46E-07	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	4.08E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	3.11E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	4.56E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	3.97E-06	mr1578	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.14E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.39E-11	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	7.55E-16	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.09E-12	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.57E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	2.23E-07	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.11E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	9.20E-06	mr1216_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.09E-10	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.94E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	4.56E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	7.77E-06	mr1483_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	5.34E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	3.10E-06	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	3.20E-09	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.78E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	5.85E-06	1.24E-06	mr1928_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	2.34E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801871198	NA	1.99E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251