\
| Variant ID: vg0801870143 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1870143 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAGAATACAAGAAAGTGGAACGTGAAGTCTGTTCGACATGGCAGGGGGCTGCACCTAATATGAAGTGGTCTGAACAGAAGATAGAATTTTCGGAAGAAGA[G/C]
CATCCCAAGACTGCCGTTATCCCAGGACGCTATCCGATCGTGGTCGAGCCCACTATTCGGAACATCAAGGTCGCGCGGGTTCTCATTGACGGTGGCAGCT
AGCTGCCACCGTCAATGAGAACCCGCGCGACCTTGATGTTCCGAATAGTGGGCTCGACCACGATCGGATAGCGTCCTGGGATAACGGCAGTCTTGGGATG[C/G]
TCTTCTTCCGAAAATTCTATCTTCTGTTCAGACCACTTCATATTAGGTGCAGCCCCCTGCCATGTCGAACAGACTTCACGTTCCACTTTCTTGTATTCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.60% | 21.60% | 0.15% | 0.63% | NA |
| All Indica | 2759 | 94.50% | 4.30% | 0.14% | 1.05% | NA |
| All Japonica | 1512 | 42.40% | 57.40% | 0.13% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 92.50% | 4.90% | 0.22% | 2.37% | NA |
| Indica III | 913 | 95.10% | 4.10% | 0.00% | 0.88% | NA |
| Indica Intermediate | 786 | 92.70% | 5.70% | 0.25% | 1.27% | NA |
| Temperate Japonica | 767 | 4.70% | 95.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.90% | 35.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801870143 | G -> C | LOC_Os08g03930.1 | missense_variant ; p.Glu724Asp; MODERATE | nonsynonymous_codon ; E724D | Average:55.052; most accessible tissue: Minghui63 flag leaf, score: 75.722 | possibly damaging |
-1.59 |
TOLERATED | 1.00 |
| vg0801870143 | G -> DEL | LOC_Os08g03930.1 | N | frameshift_variant | Average:55.052; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801870143 | NA | 1.39E-08 | mr1368 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 4.64E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 3.05E-08 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 2.51E-10 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 1.04E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 4.30E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 4.20E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 1.39E-09 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 1.44E-10 | mr1368_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | 3.92E-06 | 1.26E-07 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 3.87E-06 | mr1738_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 6.15E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 5.71E-10 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801870143 | NA | 1.45E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |