Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0801867232:

Variant ID: vg0801867232 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1867232
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.33, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGATATGCACCACATATCGACATGGCATACCCGCGCATACACGGGCATTATCTGCATATACTAAGGAAATCTTCCACAGTGTTTAAGTCCTACTCGGA[C/T]
AAGACAGGGTCGTCAATATATCGTGTAGGGTCCGATGTCTCCGAGTTCGACTTGGAGACCACTTGATTTGCGATATAAAAGGGATCCCCTGGGAGGACCT

Reverse complement sequence

AGGTCCTCCCAGGGGATCCCTTTTATATCGCAAATCAAGTGGTCTCCAAGTCGAACTCGGAGACATCGGACCCTACACGATATATTGACGACCCTGTCTT[G/A]
TCCGAGTAGGACTTAAACACTGTGGAAGATTTCCTTAGTATATGCAGATAATGCCCGTGTATGCGCGGGTATGCCATGTCGATATGTGGTGCATATCGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.00%	26.90%	0.34%	11.76%	NA
All Indica	2759	74.10%	5.70%	0.47%	19.75%	NA
All Japonica	1512	42.10%	57.60%	0.20%	0.13%	NA
Aus	269	24.20%	75.10%	0.00%	0.74%	NA
Indica I	595	70.80%	3.00%	0.34%	25.88%	NA
Indica II	465	81.90%	5.20%	0.43%	12.47%	NA
Indica III	913	74.20%	5.50%	0.22%	20.15%	NA
Indica Intermediate	786	71.90%	8.30%	0.89%	18.96%	NA
Temperate Japonica	767	4.40%	95.30%	0.13%	0.13%	NA
Tropical Japonica	504	89.10%	10.90%	0.00%	0.00%	NA
Japonica Intermediate	241	63.50%	35.30%	0.83%	0.41%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	63.30%	28.90%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801867232	C -> T	LOC_Os08g03930.1	upstream_gene_variant ; 578.0bp to feature; MODIFIER	silent_mutation	Average:47.965; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0801867232	C -> T	LOC_Os08g03910.1	downstream_gene_variant ; 1934.0bp to feature; MODIFIER	silent_mutation	Average:47.965; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0801867232	C -> T	LOC_Os08g03920.1	downstream_gene_variant ; 268.0bp to feature; MODIFIER	silent_mutation	Average:47.965; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0801867232	C -> T	LOC_Os08g03920-LOC_Os08g03930	intergenic_region ; MODIFIER	silent_mutation	Average:47.965; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg0801867232	C -> DEL	N	N	silent_mutation	Average:47.965; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801867232	NA	9.86E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	5.77E-08	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	3.07E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	6.83E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	1.64E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	2.86E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	3.55E-11	mr1350_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	1.11E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	1.45E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	1.15E-07	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	2.93E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	1.03E-16	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	1.93E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	4.63E-16	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	3.43E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	2.98E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801867232	NA	3.80E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251