Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801866117:

Variant ID: vg0801866117 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1866117
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.38, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CCATATAAACCTCCAATTGTGATGCCATGGTATCCATATCCAATGTCACTATATGGTTATCCTTTTATGTATTACATGCCATGGATGCCTCAATTCTCTA[C/T]
GCCGTTTCATCAAGGATGGGAGGAATCACCTAGGGCAGTACCAAGTCATTCTAACTCAAGACAAGACCGTTTCCCACAAAAGAATCGGTCCGGTGGATCA

Reverse complement sequence

TGATCCACCGGACCGATTCTTTTGTGGGAAACGGTCTTGTCTTGAGTTAGAATGACTTGGTACTGCCCTAGGTGATTCCTCCCATCCTTGATGAAACGGC[G/A]
TAGAGAATTGAGGCATCCATGGCATGTAATACATAAAAGGATAACCATATAGTGACATTGGATATGGATACCATGGCATCACAATTGGAGGTTTATATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	38.50%	3.11%	1.69%	NA
All Indica	2759	66.80%	25.10%	5.15%	2.90%	NA
All Japonica	1512	42.20%	57.60%	0.20%	0.00%	NA
Aus	269	24.20%	75.80%	0.00%	0.00%	NA
Indica I	595	63.90%	29.10%	4.87%	2.18%	NA
Indica II	465	75.90%	15.90%	6.45%	1.72%	NA
Indica III	913	65.30%	25.30%	4.49%	4.93%	NA
Indica Intermediate	786	65.50%	27.40%	5.34%	1.78%	NA
Temperate Japonica	767	4.60%	95.20%	0.26%	0.00%	NA
Tropical Japonica	504	89.30%	10.70%	0.00%	0.00%	NA
Japonica Intermediate	241	63.50%	36.10%	0.41%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	60.00%	37.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801866117	C -> T	LOC_Os08g03920.1	missense_variant ; p.Thr6Met; MODERATE	nonsynonymous_codon ; T6M	Average:40.237; most accessible tissue: Minghui63 root, score: 52.955	unknown	unknown	TOLERATED	1.00
vg0801866117	C -> DEL	LOC_Os08g03920.1	N	frameshift_variant	Average:40.237; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801866117	NA	2.62E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	5.13E-06	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	1.61E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	3.84E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	2.19E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	1.31E-11	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	4.70E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	1.36E-06	3.27E-15	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	4.50E-08	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	2.35E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	4.83E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	1.94E-10	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	6.98E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	5.61E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	6.59E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	1.78E-06	3.23E-06	mr1544_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	4.01E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	9.90E-12	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	3.49E-07	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	1.43E-07	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	2.62E-13	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	1.31E-14	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	2.27E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	5.11E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	1.75E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	9.53E-08	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801866117	NA	1.81E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251