\
| Variant ID: vg0801847604 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1847604 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 186. )
TACTCCAAAATGACATACACCCTCCGTCCCAAAATAAACCAACTAAAATAAATCAACTAATTAAAACATAGCTAGGATTTGAATCTTTTTGGGACGGAGA[A/G]
GGTACATACCAATAAAGTGGAAATAAAGTGGGTATATATCAACCTGCATCCAAACGCTCATACTTCATACAAACAGCCCTTCATTGGCAGGGCATCCTAT
ATAGGATGCCCTGCCAATGAAGGGCTGTTTGTATGAAGTATGAGCGTTTGGATGCAGGTTGATATATACCCACTTTATTTCCACTTTATTGGTATGTACC[T/C]
TCTCCGTCCCAAAAAGATTCAAATCCTAGCTATGTTTTAATTAGTTGATTTATTTTAGTTGGTTTATTTTGGGACGGAGGGTGTATGTCATTTTGGAGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 27.10% | 0.32% | 5.25% | NA |
| All Indica | 2759 | 77.10% | 13.60% | 0.51% | 8.74% | NA |
| All Japonica | 1512 | 42.10% | 57.70% | 0.07% | 0.07% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 69.10% | 30.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 85.40% | 2.20% | 0.86% | 11.61% | NA |
| Indica III | 913 | 79.00% | 10.30% | 0.11% | 10.62% | NA |
| Indica Intermediate | 786 | 76.20% | 11.30% | 1.02% | 11.45% | NA |
| Temperate Japonica | 767 | 4.30% | 95.60% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.50% | 36.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 18.90% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801847604 | A -> G | LOC_Os08g03880.1 | upstream_gene_variant ; 809.0bp to feature; MODIFIER | silent_mutation | Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg0801847604 | A -> G | LOC_Os08g03870.1 | downstream_gene_variant ; 1386.0bp to feature; MODIFIER | silent_mutation | Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg0801847604 | A -> G | LOC_Os08g03870.2 | downstream_gene_variant ; 1386.0bp to feature; MODIFIER | silent_mutation | Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg0801847604 | A -> G | LOC_Os08g03870-LOC_Os08g03880 | intergenic_region ; MODIFIER | silent_mutation | Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg0801847604 | A -> DEL | N | N | silent_mutation | Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801847604 | NA | 4.39E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 1.73E-07 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 1.28E-07 | mr1368 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 2.72E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 7.33E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 4.83E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 1.65E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 9.38E-09 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | 3.01E-06 | 2.91E-20 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 1.81E-10 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 1.93E-15 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 7.99E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | 5.73E-07 | 6.52E-07 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | 9.48E-09 | 1.73E-19 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 2.61E-07 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 9.35E-08 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 1.32E-07 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 2.18E-09 | mr1235_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 2.20E-10 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 4.40E-10 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 2.56E-11 | mr1368_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 4.93E-06 | mr1483_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 9.92E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 5.43E-06 | mr1544_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 3.99E-09 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 2.67E-18 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 4.77E-09 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 4.28E-06 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 2.65E-08 | mr1722_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | 5.42E-07 | 4.35E-17 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 1.56E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 2.47E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 6.72E-08 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801847604 | NA | 1.49E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |