Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801847604:

Variant ID: vg0801847604 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1847604
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCCAAAATGACATACACCCTCCGTCCCAAAATAAACCAACTAAAATAAATCAACTAATTAAAACATAGCTAGGATTTGAATCTTTTTGGGACGGAGA[A/G]
GGTACATACCAATAAAGTGGAAATAAAGTGGGTATATATCAACCTGCATCCAAACGCTCATACTTCATACAAACAGCCCTTCATTGGCAGGGCATCCTAT

Reverse complement sequence

ATAGGATGCCCTGCCAATGAAGGGCTGTTTGTATGAAGTATGAGCGTTTGGATGCAGGTTGATATATACCCACTTTATTTCCACTTTATTGGTATGTACC[T/C]
TCTCCGTCCCAAAAAGATTCAAATCCTAGCTATGTTTTAATTAGTTGATTTATTTTAGTTGGTTTATTTTGGGACGGAGGGTGTATGTCATTTTGGAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 27.10% 0.32% 5.25% NA
All Indica  2759 77.10% 13.60% 0.51% 8.74% NA
All Japonica  1512 42.10% 57.70% 0.07% 0.07% NA
Aus  269 98.50% 0.70% 0.00% 0.74% NA
Indica I  595 69.10% 30.80% 0.17% 0.00% NA
Indica II  465 85.40% 2.20% 0.86% 11.61% NA
Indica III  913 79.00% 10.30% 0.11% 10.62% NA
Indica Intermediate  786 76.20% 11.30% 1.02% 11.45% NA
Temperate Japonica  767 4.30% 95.60% 0.00% 0.13% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 36.10% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 76.70% 18.90% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801847604 A -> G LOC_Os08g03880.1 upstream_gene_variant ; 809.0bp to feature; MODIFIER silent_mutation Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0801847604 A -> G LOC_Os08g03870.1 downstream_gene_variant ; 1386.0bp to feature; MODIFIER silent_mutation Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0801847604 A -> G LOC_Os08g03870.2 downstream_gene_variant ; 1386.0bp to feature; MODIFIER silent_mutation Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0801847604 A -> G LOC_Os08g03870-LOC_Os08g03880 intergenic_region ; MODIFIER silent_mutation Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0801847604 A -> DEL N N silent_mutation Average:43.715; most accessible tissue: Minghui63 root, score: 65.279 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801847604 NA 4.39E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 1.73E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 1.28E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 2.72E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 7.33E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 4.83E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 1.65E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 9.38E-09 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 3.01E-06 2.91E-20 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 1.81E-10 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 1.93E-15 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 7.99E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 5.73E-07 6.52E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 9.48E-09 1.73E-19 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 2.61E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 9.35E-08 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 1.32E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 2.18E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 2.20E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 4.40E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 2.56E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 4.93E-06 mr1483_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 9.92E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 5.43E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 3.99E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 2.67E-18 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 4.77E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 4.28E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 2.65E-08 mr1722_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 5.42E-07 4.35E-17 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 1.56E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 2.47E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 6.72E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847604 NA 1.49E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251