\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801847600:

Variant ID: vg0801847600 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1847600
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, G: 0.11, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTTACTCCAAAATGACATACACCCTCCGTCCCAAAATAAACCAACTAAAATAAATCAACTAATTAAAACATAGCTAGGATTTGAATCTTTTTGGGACG[G/T]
AGAAGGTACATACCAATAAAGTGGAAATAAAGTGGGTATATATCAACCTGCATCCAAACGCTCATACTTCATACAAACAGCCCTTCATTGGCAGGGCATC

Reverse complement sequence

GATGCCCTGCCAATGAAGGGCTGTTTGTATGAAGTATGAGCGTTTGGATGCAGGTTGATATATACCCACTTTATTTCCACTTTATTGGTATGTACCTTCT[C/A]
CGTCCCAAAAAGATTCAAATCCTAGCTATGTTTTAATTAGTTGATTTATTTTAGTTGGTTTATTTTGGGACGGAGGGTGTATGTCATTTTGGAGTAAGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 27.10% 0.34% 5.27% NA
All Indica  2759 77.10% 13.60% 0.54% 8.77% NA
All Japonica  1512 42.10% 57.70% 0.07% 0.07% NA
Aus  269 98.50% 0.70% 0.00% 0.74% NA
Indica I  595 69.10% 30.80% 0.17% 0.00% NA
Indica II  465 85.40% 2.20% 0.86% 11.61% NA
Indica III  913 79.00% 10.30% 0.11% 10.62% NA
Indica Intermediate  786 76.00% 11.30% 1.15% 11.58% NA
Temperate Japonica  767 4.30% 95.60% 0.00% 0.13% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 36.10% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 74.40% 21.10% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801847600 G -> T LOC_Os08g03880.1 upstream_gene_variant ; 813.0bp to feature; MODIFIER silent_mutation Average:43.65; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0801847600 G -> T LOC_Os08g03870.1 downstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:43.65; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0801847600 G -> T LOC_Os08g03870.2 downstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:43.65; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0801847600 G -> T LOC_Os08g03870-LOC_Os08g03880 intergenic_region ; MODIFIER silent_mutation Average:43.65; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0801847600 G -> DEL N N silent_mutation Average:43.65; most accessible tissue: Minghui63 root, score: 65.279 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801847600 NA 2.24E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 1.73E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 1.28E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 2.49E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 7.33E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 1.65E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 9.38E-09 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 3.21E-06 2.35E-20 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 1.59E-10 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 1.93E-15 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 8.78E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 4.60E-07 4.44E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 6.82E-09 7.31E-20 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 2.61E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 9.35E-08 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 1.32E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 2.18E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 2.20E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 4.40E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 2.56E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 4.13E-06 mr1483_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 9.92E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 5.39E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 3.99E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 1.68E-18 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 3.21E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 5.08E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 4.56E-08 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 4.68E-07 2.49E-17 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 2.12E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 2.47E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 8.14E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801847600 NA 1.49E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251