\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801845030:

Variant ID: vg0801845030 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1845030
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, G: 0.13, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGAAAACATTTATTTCTTCAGATGGTTTCTACAGTACCAAGTTAATGAACAATATTGGTTGTAGCATAGTAATAGTATTGATACTACCCAACCCTATT[G/T]
GTCACTAGTGTTGCACTGTTGCTCAGGCATCATTTTAGATTGCTCATTTCTATGCCTTGATGATTTTTCGGGTTCTGGTATATTAAGGATTTTTTTTCTT

Reverse complement sequence

AAGAAAAAAAATCCTTAATATACCAGAACCCGAAAAATCATCAAGGCATAGAAATGAGCAATCTAAAATGATGCCTGAGCAACAGTGCAACACTAGTGAC[C/A]
AATAGGGTTGGGTAGTATCAATACTATTACTATGCTACAACCAATATTGTTCATTAACTTGGTACTGTAGAAACCATCTGAAGAAATAAATGTTTTCAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 27.40% 5.14% 0.17% NA
All Indica  2759 77.00% 14.20% 8.55% 0.25% NA
All Japonica  1512 42.20% 57.70% 0.13% 0.00% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 69.10% 30.80% 0.17% 0.00% NA
Indica II  465 85.20% 3.20% 11.61% 0.00% NA
Indica III  913 79.10% 10.50% 10.30% 0.11% NA
Indica Intermediate  786 75.80% 12.30% 11.07% 0.76% NA
Temperate Japonica  767 4.40% 95.40% 0.13% 0.00% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 36.10% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 74.40% 21.10% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801845030 G -> T LOC_Os08g03880.1 upstream_gene_variant ; 3383.0bp to feature; MODIFIER silent_mutation Average:60.546; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg0801845030 G -> T LOC_Os08g03860.1 downstream_gene_variant ; 3785.0bp to feature; MODIFIER silent_mutation Average:60.546; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg0801845030 G -> T LOC_Os08g03870.1 intron_variant ; MODIFIER silent_mutation Average:60.546; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg0801845030 G -> T LOC_Os08g03870.2 intron_variant ; MODIFIER silent_mutation Average:60.546; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg0801845030 G -> DEL N N silent_mutation Average:60.546; most accessible tissue: Minghui63 flower, score: 77.844 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801845030 NA 1.73E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.28E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 7.33E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.65E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 9.38E-09 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.36E-17 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 8.37E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.93E-15 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 1.33E-08 4.26E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 4.47E-11 2.32E-22 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 2.61E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 9.35E-08 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.32E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 2.18E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 2.20E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 4.40E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 2.56E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.07E-06 mr1483_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 9.92E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.18E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 3.81E-06 4.53E-06 mr1544_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 3.99E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 9.36E-17 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 2.30E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 4.04E-07 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.35E-07 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 3.25E-06 NA mr1739_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 5.00E-09 1.11E-18 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.61E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 2.47E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 4.27E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 2.38E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801845030 NA 1.49E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251