| Variant ID: vg0801815194 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1815194 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGAAAATTTCTAGCTTCCACAGCGAACGTGATGCTTTTTTTTAGCTGTCTTAATAATATAATAATAGATAGATAGATATTTTTTGCGAGCCGAAAAAATC[A/G]
GGGCGTTAAAATGGCGGCGCTGCCCGAACACCAGCAAGCTGCCCCAACCCAACGCTGAGGTCTGGTGGTGACGCGCGCGGCCTGGCGGAGGCGGCGGCAG
CTGCCGCCGCCTCCGCCAGGCCGCGCGCGTCACCACCAGACCTCAGCGTTGGGTTGGGGCAGCTTGCTGGTGTTCGGGCAGCGCCGCCATTTTAACGCCC[T/C]
GATTTTTTCGGCTCGCAAAAAATATCTATCTATCTATTATTATATTATTAAGACAGCTAAAAAAAAGCATCACGTTCGCTGTGGAAGCTAGAAATTTTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.70% | 19.90% | 0.15% | 24.25% | NA |
| All Indica | 2759 | 59.80% | 1.30% | 0.18% | 38.67% | NA |
| All Japonica | 1512 | 41.70% | 58.00% | 0.00% | 0.26% | NA |
| Aus | 269 | 78.10% | 0.40% | 0.00% | 21.56% | NA |
| Indica I | 595 | 94.30% | 2.20% | 0.00% | 3.53% | NA |
| Indica II | 465 | 76.10% | 1.50% | 0.00% | 22.37% | NA |
| Indica III | 913 | 25.30% | 0.20% | 0.33% | 74.15% | NA |
| Indica Intermediate | 786 | 64.20% | 1.80% | 0.25% | 33.72% | NA |
| Temperate Japonica | 767 | 4.20% | 95.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 89.10% | 10.50% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 62.20% | 37.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 17.80% | 2.22% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801815194 | A -> G | LOC_Os08g03800.1 | downstream_gene_variant ; 1536.0bp to feature; MODIFIER | silent_mutation | Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0801815194 | A -> G | LOC_Os08g03810.1 | downstream_gene_variant ; 3435.0bp to feature; MODIFIER | silent_mutation | Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0801815194 | A -> G | LOC_Os08g03790-LOC_Os08g03800 | intergenic_region ; MODIFIER | silent_mutation | Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0801815194 | A -> DEL | N | N | silent_mutation | Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801815194 | NA | 4.11E-08 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801815194 | NA | 2.97E-08 | mr1368 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801815194 | NA | 8.90E-08 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801815194 | NA | 1.53E-06 | mr1509 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801815194 | NA | 4.29E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801815194 | NA | 1.64E-09 | mr1584 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801815194 | NA | 4.20E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801815194 | NA | 2.08E-08 | mr1942 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801815194 | NA | 3.13E-09 | mr1235_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801815194 | NA | 2.63E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/