\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801815194:

Variant ID: vg0801815194 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1815194
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAAATTTCTAGCTTCCACAGCGAACGTGATGCTTTTTTTTAGCTGTCTTAATAATATAATAATAGATAGATAGATATTTTTTGCGAGCCGAAAAAATC[A/G]
GGGCGTTAAAATGGCGGCGCTGCCCGAACACCAGCAAGCTGCCCCAACCCAACGCTGAGGTCTGGTGGTGACGCGCGCGGCCTGGCGGAGGCGGCGGCAG

Reverse complement sequence

CTGCCGCCGCCTCCGCCAGGCCGCGCGCGTCACCACCAGACCTCAGCGTTGGGTTGGGGCAGCTTGCTGGTGTTCGGGCAGCGCCGCCATTTTAACGCCC[T/C]
GATTTTTTCGGCTCGCAAAAAATATCTATCTATCTATTATTATATTATTAAGACAGCTAAAAAAAAGCATCACGTTCGCTGTGGAAGCTAGAAATTTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 19.90% 0.15% 24.25% NA
All Indica  2759 59.80% 1.30% 0.18% 38.67% NA
All Japonica  1512 41.70% 58.00% 0.00% 0.26% NA
Aus  269 78.10% 0.40% 0.00% 21.56% NA
Indica I  595 94.30% 2.20% 0.00% 3.53% NA
Indica II  465 76.10% 1.50% 0.00% 22.37% NA
Indica III  913 25.30% 0.20% 0.33% 74.15% NA
Indica Intermediate  786 64.20% 1.80% 0.25% 33.72% NA
Temperate Japonica  767 4.20% 95.70% 0.00% 0.13% NA
Tropical Japonica  504 89.10% 10.50% 0.00% 0.40% NA
Japonica Intermediate  241 62.20% 37.30% 0.00% 0.41% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 61.10% 17.80% 2.22% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801815194 A -> G LOC_Os08g03800.1 downstream_gene_variant ; 1536.0bp to feature; MODIFIER silent_mutation Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0801815194 A -> G LOC_Os08g03810.1 downstream_gene_variant ; 3435.0bp to feature; MODIFIER silent_mutation Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0801815194 A -> G LOC_Os08g03790-LOC_Os08g03800 intergenic_region ; MODIFIER silent_mutation Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0801815194 A -> DEL N N silent_mutation Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801815194 NA 4.11E-08 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 2.97E-08 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 8.90E-08 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 1.53E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 4.29E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 1.64E-09 mr1584 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 4.20E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 2.08E-08 mr1942 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 3.13E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 2.63E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 6.44E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 1.51E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 1.26E-10 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 2.69E-17 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 4.45E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194 NA 4.42E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251