Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801815194:

Variant ID: vg0801815194 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1815194
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAAATTTCTAGCTTCCACAGCGAACGTGATGCTTTTTTTTAGCTGTCTTAATAATATAATAATAGATAGATAGATATTTTTTGCGAGCCGAAAAAATC[A/G]
GGGCGTTAAAATGGCGGCGCTGCCCGAACACCAGCAAGCTGCCCCAACCCAACGCTGAGGTCTGGTGGTGACGCGCGCGGCCTGGCGGAGGCGGCGGCAG

Reverse complement sequence

CTGCCGCCGCCTCCGCCAGGCCGCGCGCGTCACCACCAGACCTCAGCGTTGGGTTGGGGCAGCTTGCTGGTGTTCGGGCAGCGCCGCCATTTTAACGCCC[T/C]
GATTTTTTCGGCTCGCAAAAAATATCTATCTATCTATTATTATATTATTAAGACAGCTAAAAAAAAGCATCACGTTCGCTGTGGAAGCTAGAAATTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.70%	19.90%	0.15%	24.25%	NA
All Indica	2759	59.80%	1.30%	0.18%	38.67%	NA
All Japonica	1512	41.70%	58.00%	0.00%	0.26%	NA
Aus	269	78.10%	0.40%	0.00%	21.56%	NA
Indica I	595	94.30%	2.20%	0.00%	3.53%	NA
Indica II	465	76.10%	1.50%	0.00%	22.37%	NA
Indica III	913	25.30%	0.20%	0.33%	74.15%	NA
Indica Intermediate	786	64.20%	1.80%	0.25%	33.72%	NA
Temperate Japonica	767	4.20%	95.70%	0.00%	0.13%	NA
Tropical Japonica	504	89.10%	10.50%	0.00%	0.40%	NA
Japonica Intermediate	241	62.20%	37.30%	0.00%	0.41%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	61.10%	17.80%	2.22%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801815194	A -> G	LOC_Os08g03800.1	downstream_gene_variant ; 1536.0bp to feature; MODIFIER	silent_mutation	Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0801815194	A -> G	LOC_Os08g03810.1	downstream_gene_variant ; 3435.0bp to feature; MODIFIER	silent_mutation	Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0801815194	A -> G	LOC_Os08g03790-LOC_Os08g03800	intergenic_region ; MODIFIER	silent_mutation	Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0801815194	A -> DEL	N	N	silent_mutation	Average:72.32; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801815194	NA	4.11E-08	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	2.97E-08	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	8.90E-08	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	1.53E-06	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	4.29E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	1.64E-09	mr1584	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	4.20E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	2.08E-08	mr1942	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	3.13E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	2.63E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	6.44E-10	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	1.51E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	1.26E-10	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	2.69E-17	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	4.45E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801815194	NA	4.42E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251