\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801802005:

Variant ID: vg0801802005 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1802005
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGTACACGGTTATTAAGAAAGTAGGTAGAAGAAAGTGGTGGAGGATTGTGACTGGATAAGTAGTGGAGATATGTGGAAAAAGCGAATGGTGGAGGGTT[G/A]
TGATTGATTGGGAATAAAAGTTGTTATATTTTGGGACAAATCCTGAGGGCTAAAAGTTGTTATATTTTTGGACGGAGGGAGTACTATATTTTATAAAATA

Reverse complement sequence

TATTTTATAAAATATAGTACTCCCTCCGTCCAAAAATATAACAACTTTTAGCCCTCAGGATTTGTCCCAAAATATAACAACTTTTATTCCCAATCAATCA[C/T]
AACCCTCCACCATTCGCTTTTTCCACATATCTCCACTACTTATCCAGTCACAATCCTCCACCACTTTCTTCTACCTACTTTCTTAATAACCGTGTACAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 8.70% 0.36% 23.70% NA
All Indica  2759 49.20% 12.40% 0.58% 37.80% NA
All Japonica  1512 99.70% 0.10% 0.00% 0.26% NA
Aus  269 55.80% 22.70% 0.37% 21.19% NA
Indica I  595 68.60% 27.90% 0.00% 3.53% NA
Indica II  465 77.40% 0.60% 0.65% 21.29% NA
Indica III  913 15.80% 10.30% 0.66% 73.27% NA
Indica Intermediate  786 56.60% 10.20% 0.89% 32.32% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 78.90% 3.30% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801802005 G -> A LOC_Os08g03780.1 downstream_gene_variant ; 2789.0bp to feature; MODIFIER silent_mutation Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg0801802005 G -> A LOC_Os08g03790.1 downstream_gene_variant ; 736.0bp to feature; MODIFIER silent_mutation Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg0801802005 G -> A LOC_Os08g03790-LOC_Os08g03800 intergenic_region ; MODIFIER silent_mutation Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg0801802005 G -> DEL N N silent_mutation Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801802005 5.07E-07 2.24E-16 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005 2.00E-07 3.97E-15 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005 NA 2.30E-06 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005 5.36E-06 5.84E-19 mr1739_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005 NA 5.74E-14 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005 NA 1.37E-08 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005 NA 7.50E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005 NA 6.77E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251