\
| Variant ID: vg0801802005 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1802005 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTGTACACGGTTATTAAGAAAGTAGGTAGAAGAAAGTGGTGGAGGATTGTGACTGGATAAGTAGTGGAGATATGTGGAAAAAGCGAATGGTGGAGGGTT[G/A]
TGATTGATTGGGAATAAAAGTTGTTATATTTTGGGACAAATCCTGAGGGCTAAAAGTTGTTATATTTTTGGACGGAGGGAGTACTATATTTTATAAAATA
TATTTTATAAAATATAGTACTCCCTCCGTCCAAAAATATAACAACTTTTAGCCCTCAGGATTTGTCCCAAAATATAACAACTTTTATTCCCAATCAATCA[C/T]
AACCCTCCACCATTCGCTTTTTCCACATATCTCCACTACTTATCCAGTCACAATCCTCCACCACTTTCTTCTACCTACTTTCTTAATAACCGTGTACAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.30% | 8.70% | 0.36% | 23.70% | NA |
| All Indica | 2759 | 49.20% | 12.40% | 0.58% | 37.80% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.00% | 0.26% | NA |
| Aus | 269 | 55.80% | 22.70% | 0.37% | 21.19% | NA |
| Indica I | 595 | 68.60% | 27.90% | 0.00% | 3.53% | NA |
| Indica II | 465 | 77.40% | 0.60% | 0.65% | 21.29% | NA |
| Indica III | 913 | 15.80% | 10.30% | 0.66% | 73.27% | NA |
| Indica Intermediate | 786 | 56.60% | 10.20% | 0.89% | 32.32% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 3.30% | 0.00% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801802005 | G -> A | LOC_Os08g03780.1 | downstream_gene_variant ; 2789.0bp to feature; MODIFIER | silent_mutation | Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657 | N | N | N | N |
| vg0801802005 | G -> A | LOC_Os08g03790.1 | downstream_gene_variant ; 736.0bp to feature; MODIFIER | silent_mutation | Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657 | N | N | N | N |
| vg0801802005 | G -> A | LOC_Os08g03790-LOC_Os08g03800 | intergenic_region ; MODIFIER | silent_mutation | Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657 | N | N | N | N |
| vg0801802005 | G -> DEL | N | N | silent_mutation | Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801802005 | 5.07E-07 | 2.24E-16 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801802005 | 2.00E-07 | 3.97E-15 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801802005 | NA | 2.30E-06 | mr1722_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801802005 | 5.36E-06 | 5.84E-19 | mr1739_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801802005 | NA | 5.74E-14 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801802005 | NA | 1.37E-08 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801802005 | NA | 7.50E-07 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801802005 | NA | 6.77E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |