\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801799117:

Variant ID: vg0801799117 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1799117
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, A: 0.31, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAAGTAGAAGCTGTTGGAGTCTTTGCCTAGAGCTCCCGATTGGCTTCACACTTTTACTTCGAGATGTTTTTTATGTAATTTAATAAGTGTATCGAAAT[A/T]
GGATTTTGATGGATATGATTGCCATTTTGGAAATGGCAAATGTGAACTATGGTATAATAATGCATGTATTGGTCTTGCTGTGTTGCAAGATGAGCTTTAT

Reverse complement sequence

ATAAAGCTCATCTTGCAACACAGCAAGACCAATACATGCATTATTATACCATAGTTCACATTTGCCATTTCCAAAATGGCAATCATATCCATCAAAATCC[T/A]
ATTTCGATACACTTATTAAATTACATAAAAAACATCTCGAAGTAAAAGTGTGAAGCCAATCGGGAGCTCTAGGCAAAGACTCCAACAGCTTCTACTTTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 33.60% 3.96% 12.80% NA
All Indica  2759 48.00% 26.40% 5.58% 20.01% NA
All Japonica  1512 59.10% 38.20% 0.26% 2.45% NA
Aus  269 0.70% 87.40% 8.92% 2.97% NA
Indica I  595 68.20% 28.40% 0.34% 3.03% NA
Indica II  465 76.80% 14.20% 2.15% 6.88% NA
Indica III  913 14.50% 31.50% 13.25% 40.74% NA
Indica Intermediate  786 54.70% 26.10% 2.67% 16.54% NA
Temperate Japonica  767 97.00% 2.90% 0.13% 0.00% NA
Tropical Japonica  504 10.90% 86.30% 0.40% 2.38% NA
Japonica Intermediate  241 39.00% 50.20% 0.41% 10.37% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 47.80% 37.80% 5.56% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801799117 A -> T LOC_Os08g03780.1 3_prime_UTR_variant ; 296.0bp to feature; MODIFIER silent_mutation Average:27.395; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0801799117 A -> T LOC_Os08g03770.1 upstream_gene_variant ; 4231.0bp to feature; MODIFIER silent_mutation Average:27.395; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0801799117 A -> T LOC_Os08g03790.1 upstream_gene_variant ; 666.0bp to feature; MODIFIER silent_mutation Average:27.395; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0801799117 A -> DEL N N silent_mutation Average:27.395; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801799117 NA 1.79E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 2.97E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 1.41E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 2.37E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 4.22E-10 3.61E-22 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 5.59E-11 1.84E-23 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 2.09E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 5.42E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 3.28E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 3.76E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 8.15E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 5.40E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 9.53E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 1.83E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 9.86E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 1.24E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 6.47E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 1.23E-09 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 3.94E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 3.01E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 2.18E-06 mr1483_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 2.16E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 6.74E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 9.89E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 5.19E-07 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 9.39E-10 5.93E-25 mr1739_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 9.34E-07 1.54E-19 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 4.87E-14 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 2.88E-17 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 5.38E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 2.20E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799117 NA 5.61E-10 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251