\
| Variant ID: vg0801793113 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1793113 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )
TTGGGTTTGAATGTTTCTCTTACAAACAATTAATACAGTGATGCAATACTTGTTACAACAGCCTCTAAACTTTCAATCTTCTACATTACAACACAGCCTT[A/G]
CACCCTTGTGTTGCATATTGCAATGGCAGGAAAAAGAATAGCCAGATATGAGCTTACAGGCAAACAGAAATTACCAAGTGGAGTACAATTTCAACGGCAC
GTGCCGTTGAAATTGTACTCCACTTGGTAATTTCTGTTTGCCTGTAAGCTCATATCTGGCTATTCTTTTTCCTGCCATTGCAATATGCAACACAAGGGTG[T/C]
AAGGCTGTGTTGTAATGTAGAAGATTGAAAGTTTAGAGGCTGTTGTAACAAGTATTGCATCACTGTATTAATTGTTTGTAAGAGAAACATTCAAACCCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.30% | 20.40% | 0.04% | 1.23% | NA |
| All Indica | 2759 | 98.80% | 0.90% | 0.04% | 0.29% | NA |
| All Japonica | 1512 | 44.10% | 55.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 81.40% | 0.40% | 0.00% | 18.22% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.20% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 98.00% | 1.30% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 69.70% | 30.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801793113 | A -> G | LOC_Os08g03760.1 | upstream_gene_variant ; 4397.0bp to feature; MODIFIER | silent_mutation | Average:43.311; most accessible tissue: Callus, score: 67.856 | N | N | N | N |
| vg0801793113 | A -> G | LOC_Os08g03780.1 | upstream_gene_variant ; 2678.0bp to feature; MODIFIER | silent_mutation | Average:43.311; most accessible tissue: Callus, score: 67.856 | N | N | N | N |
| vg0801793113 | A -> G | LOC_Os08g03770.1 | downstream_gene_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:43.311; most accessible tissue: Callus, score: 67.856 | N | N | N | N |
| vg0801793113 | A -> G | LOC_Os08g03760-LOC_Os08g03770 | intergenic_region ; MODIFIER | silent_mutation | Average:43.311; most accessible tissue: Callus, score: 67.856 | N | N | N | N |
| vg0801793113 | A -> DEL | N | N | silent_mutation | Average:43.311; most accessible tissue: Callus, score: 67.856 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801793113 | NA | 1.22E-09 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 3.16E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 2.15E-07 | mr1368 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 3.04E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 2.53E-08 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 1.30E-12 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 4.82E-07 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 4.99E-24 | mr1077_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 3.85E-19 | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 3.59E-07 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 8.11E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 3.79E-10 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 6.44E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 3.81E-11 | mr1368_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 2.39E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 5.63E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 8.68E-17 | mr1539_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 4.54E-18 | mr1540_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 5.22E-09 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 3.05E-06 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 1.93E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 1.64E-16 | mr1732_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | 3.44E-06 | 8.21E-07 | mr1738_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 1.19E-09 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 1.73E-07 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 1.95E-08 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 1.39E-16 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 1.46E-09 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801793113 | NA | 3.76E-09 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |