\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801793113:

Variant ID: vg0801793113 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1793113
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGGTTTGAATGTTTCTCTTACAAACAATTAATACAGTGATGCAATACTTGTTACAACAGCCTCTAAACTTTCAATCTTCTACATTACAACACAGCCTT[A/G]
CACCCTTGTGTTGCATATTGCAATGGCAGGAAAAAGAATAGCCAGATATGAGCTTACAGGCAAACAGAAATTACCAAGTGGAGTACAATTTCAACGGCAC

Reverse complement sequence

GTGCCGTTGAAATTGTACTCCACTTGGTAATTTCTGTTTGCCTGTAAGCTCATATCTGGCTATTCTTTTTCCTGCCATTGCAATATGCAACACAAGGGTG[T/C]
AAGGCTGTGTTGTAATGTAGAAGATTGAAAGTTTAGAGGCTGTTGTAACAAGTATTGCATCACTGTATTAATTGTTTGTAAGAGAAACATTCAAACCCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 20.40% 0.04% 1.23% NA
All Indica  2759 98.80% 0.90% 0.04% 0.29% NA
All Japonica  1512 44.10% 55.80% 0.07% 0.00% NA
Aus  269 81.40% 0.40% 0.00% 18.22% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.50% 0.20% 0.00% 0.33% NA
Indica Intermediate  786 98.00% 1.30% 0.13% 0.64% NA
Temperate Japonica  767 6.30% 93.70% 0.00% 0.00% NA
Tropical Japonica  504 89.50% 10.30% 0.20% 0.00% NA
Japonica Intermediate  241 69.70% 30.30% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801793113 A -> G LOC_Os08g03760.1 upstream_gene_variant ; 4397.0bp to feature; MODIFIER silent_mutation Average:43.311; most accessible tissue: Callus, score: 67.856 N N N N
vg0801793113 A -> G LOC_Os08g03780.1 upstream_gene_variant ; 2678.0bp to feature; MODIFIER silent_mutation Average:43.311; most accessible tissue: Callus, score: 67.856 N N N N
vg0801793113 A -> G LOC_Os08g03770.1 downstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:43.311; most accessible tissue: Callus, score: 67.856 N N N N
vg0801793113 A -> G LOC_Os08g03760-LOC_Os08g03770 intergenic_region ; MODIFIER silent_mutation Average:43.311; most accessible tissue: Callus, score: 67.856 N N N N
vg0801793113 A -> DEL N N silent_mutation Average:43.311; most accessible tissue: Callus, score: 67.856 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801793113 NA 1.22E-09 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 3.16E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 2.15E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 3.04E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 2.53E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 1.30E-12 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 4.82E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 4.99E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 3.85E-19 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 3.59E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 8.11E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 3.79E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 6.44E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 3.81E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 2.39E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 5.63E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 8.68E-17 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 4.54E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 5.22E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 3.05E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 1.93E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 1.64E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 3.44E-06 8.21E-07 mr1738_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 1.19E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 1.73E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 1.95E-08 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 1.39E-16 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 1.46E-09 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801793113 NA 3.76E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251