\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801792763:

Variant ID: vg0801792763 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1792763
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAGGAGCATATGCATGTGTTTTGCTCCATTTGTTACACTTCTATTATAGATTTTTCACATGTCAGAAATTGGATGATGTAGGATATATTAATTATGAA[A/C]
TTCCTGGTTTTGTCTAAAAATGTCGCTGGCCTTTAAACCGAAGACGATGATGAGGAACACCCGCTTATTCCTGGTTTTTTGTCTAAATTGGATGCGTCCT

Reverse complement sequence

AGGACGCATCCAATTTAGACAAAAAACCAGGAATAAGCGGGTGTTCCTCATCATCGTCTTCGGTTTAAAGGCCAGCGACATTTTTAGACAAAACCAGGAA[T/G]
TTCATAATTAATATATCCTACATCATCCAATTTCTGACATGTGAAAAATCTATAATAGAAGTGTAACAAATGGAGCAAAACACATGCATATGCTCCTGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 13.90% 0.08% 1.23% NA
All Indica  2759 99.30% 0.40% 0.00% 0.29% NA
All Japonica  1512 58.60% 41.20% 0.20% 0.00% NA
Aus  269 81.40% 0.00% 0.37% 18.22% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.00% 0.00% 0.33% NA
Indica Intermediate  786 98.60% 0.80% 0.00% 0.64% NA
Temperate Japonica  767 97.30% 2.60% 0.13% 0.00% NA
Tropical Japonica  504 11.70% 88.10% 0.20% 0.00% NA
Japonica Intermediate  241 33.60% 66.00% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801792763 A -> C LOC_Os08g03760.1 upstream_gene_variant ; 4047.0bp to feature; MODIFIER silent_mutation Average:42.824; most accessible tissue: Callus, score: 80.975 N N N N
vg0801792763 A -> C LOC_Os08g03780.1 upstream_gene_variant ; 3028.0bp to feature; MODIFIER silent_mutation Average:42.824; most accessible tissue: Callus, score: 80.975 N N N N
vg0801792763 A -> C LOC_Os08g03770.1 downstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:42.824; most accessible tissue: Callus, score: 80.975 N N N N
vg0801792763 A -> C LOC_Os08g03760-LOC_Os08g03770 intergenic_region ; MODIFIER silent_mutation Average:42.824; most accessible tissue: Callus, score: 80.975 N N N N
vg0801792763 A -> DEL N N silent_mutation Average:42.824; most accessible tissue: Callus, score: 80.975 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801792763 NA 2.42E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 3.61E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.70E-09 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 8.44E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 9.03E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 5.68E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 4.83E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.65E-29 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 9.97E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.15E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.00E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 5.46E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.92E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 9.43E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 7.89E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 5.03E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 7.56E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 8.93E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 3.03E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.28E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.94E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.38E-09 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.85E-12 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 6.41E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 8.14E-09 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.13E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.30E-07 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.36E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 3.02E-07 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 8.75E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.10E-09 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 6.47E-07 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 3.48E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.82E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 4.10E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.37E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.28E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 3.49E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 3.78E-07 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.36E-18 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.02E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 4.48E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 7.16E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 6.52E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.26E-10 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.02E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.31E-31 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 9.37E-07 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.15E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 8.96E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.47E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 4.07E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 3.40E-08 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 3.71E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 5.09E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.32E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.17E-12 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.36E-18 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 6.82E-11 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 1.41E-22 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 4.72E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.77E-11 mr1952_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.43E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801792763 NA 2.92E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251