\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801788465:

Variant ID: vg0801788465 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1788465
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, C: 0.33, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGCTTGTCGGATATCTTGCAAAACTGCTTTACCCCTTTGCTGTTGGAGGGCGATTCCAGAGTTATGATAACCTCAGCCTCAGATGAAATCGCGGACAT[C/A]
AGCTGTCCATAGCTTGTGGCGAGATTGCTTAACTCCAGGTAGAAGATTGATGAATGGCCGGGCTGTTCAATGCAAGAAAAAGATGATGAGATAAGAGATA

Reverse complement sequence

TATCTCTTATCTCATCATCTTTTTCTTGCATTGAACAGCCCGGCCATTCATCAATCTTCTACCTGGAGTTAAGCAATCTCGCCACAAGCTATGGACAGCT[G/T]
ATGTCCGCGATTTCATCTGAGGCTGAGGTTATCATAACTCTGGAATCGCCCTCCAACAGCAAAGGGGTAAAGCAGTTTTGCAAGATATCCGACAAGCTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 33.10% 0.06% 1.23% NA
All Indica  2759 85.80% 13.80% 0.07% 0.29% NA
All Japonica  1512 38.90% 61.10% 0.00% 0.00% NA
Aus  269 26.40% 55.40% 0.00% 18.22% NA
Indica I  595 70.30% 29.70% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 88.50% 11.10% 0.11% 0.33% NA
Indica Intermediate  786 87.50% 11.70% 0.13% 0.64% NA
Temperate Japonica  767 5.20% 94.80% 0.00% 0.00% NA
Tropical Japonica  504 86.50% 13.50% 0.00% 0.00% NA
Japonica Intermediate  241 46.50% 53.50% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801788465 C -> A LOC_Os08g03760.1 synonymous_variant ; p.Leu41Leu; LOW synonymous_codon Average:52.788; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N
vg0801788465 C -> DEL LOC_Os08g03760.1 N frameshift_variant Average:52.788; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801788465 NA 2.05E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 3.20E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 9.86E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 2.46E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 3.18E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 7.82E-06 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 3.54E-12 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 2.75E-06 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 4.27E-06 4.26E-06 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 9.59E-06 2.08E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 2.68E-10 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 1.53E-06 7.06E-08 mr1663_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 2.09E-12 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 5.53E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 2.94E-08 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801788465 NA 5.98E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251