\
| Variant ID: vg0801775717 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1775717 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGATGACATGACGATAGAAGAATTTGTTATTGACACC[G/A]
GTCTATCTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTATGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGT
ACCAGCTCGGGCTTGACAAGCGGTTTACCGAGTTCATACATGTATTTCAATTCCGCCTTTTCTATTGGTTCAACTCCTAGCAATTGATCCGTAGATAGAC[C/T]
GGTGTCAATAACAAATTCTTCTATCGTCATGTCATCCCCGGTCACCAACGGCTCGATCTCCTGGTTTGGTTGCTCTCCAAGCTGAGGGACTGGTTTGGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.00% | 0.10% | 16.69% | 44.16% | NA |
| All Indica | 2759 | 3.00% | 0.20% | 26.60% | 70.24% | NA |
| All Japonica | 1512 | 97.90% | 0.00% | 0.66% | 1.46% | NA |
| Aus | 269 | 55.40% | 0.00% | 10.78% | 33.83% | NA |
| Indica I | 595 | 3.50% | 0.20% | 14.79% | 81.51% | NA |
| Indica II | 465 | 2.80% | 0.60% | 15.05% | 81.51% | NA |
| Indica III | 913 | 1.10% | 0.00% | 35.82% | 63.09% | NA |
| Indica Intermediate | 786 | 4.80% | 0.10% | 31.68% | 63.36% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.39% | 1.69% | NA |
| Tropical Japonica | 504 | 98.40% | 0.00% | 0.60% | 0.99% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 1.66% | 1.66% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 50.00% | 1.10% | 15.56% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801775717 | G -> A | LOC_Os08g03730.1 | missense_variant ; p.Gly685Ser; MODERATE | nonsynonymous_codon ; G685N | Average:10.887; most accessible tissue: Minghui63 root, score: 21.615 | probably damaging |
2.122 |
DELETERIOUS | 0.00 |
| vg0801775717 | G -> DEL | LOC_Os08g03730.1 | N | frameshift_variant | Average:10.887; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801775717 | NA | 7.45E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | 4.58E-07 | 2.95E-11 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | 1.69E-07 | 1.16E-17 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 1.71E-08 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 9.86E-07 | mr1472_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 1.66E-07 | mr1483_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 2.46E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 5.95E-06 | mr1722_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 1.08E-10 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 1.38E-14 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 1.62E-13 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 6.32E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775717 | NA | 1.84E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |