\
| Variant ID: vg0801775699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1775699 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAAAGCATCTTTTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGATGACATGACGATAGAA[G/A]
AATTTGTTATTGACACCGGTCTATCTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTATGAACTCGGTAAACCGCT
AGCGGTTTACCGAGTTCATACATGTATTTCAATTCCGCCTTTTCTATTGGTTCAACTCCTAGCAATTGATCCGTAGATAGACCGGTGTCAATAACAAATT[C/T]
TTCTATCGTCATGTCATCCCCGGTCACCAACGGCTCGATCTCCTGGTTTGGTTGCTCTCCAAGCTGAGGGACTGGTTTGGACTTTCCAAAAGATGCTTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.30% | 0.10% | 17.22% | 43.33% | NA |
| All Indica | 2759 | 3.20% | 0.20% | 27.87% | 68.79% | NA |
| All Japonica | 1512 | 98.30% | 0.00% | 0.26% | 1.46% | NA |
| Aus | 269 | 55.40% | 0.00% | 9.67% | 34.94% | NA |
| Indica I | 595 | 3.40% | 0.20% | 15.13% | 81.34% | NA |
| Indica II | 465 | 3.00% | 0.60% | 15.91% | 80.43% | NA |
| Indica III | 913 | 1.60% | 0.00% | 38.66% | 59.69% | NA |
| Indica Intermediate | 786 | 4.80% | 0.10% | 32.06% | 62.98% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 0.13% | 1.69% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.20% | 0.99% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 53.30% | 1.10% | 14.44% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801775699 | G -> A | LOC_Os08g03730.1 | missense_variant ; p.Glu679Lys; MODERATE | nonsynonymous_codon ; E679K | Average:11.153; most accessible tissue: Minghui63 root, score: 21.615 | benign |
0.917 |
DELETERIOUS | 0.01 |
| vg0801775699 | G -> DEL | LOC_Os08g03730.1 | N | frameshift_variant | Average:11.153; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801775699 | NA | 5.71E-10 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | NA | 6.77E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | 3.78E-07 | 5.53E-10 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | 1.03E-07 | 1.84E-17 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | NA | 8.11E-08 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | NA | 1.01E-12 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | NA | 1.75E-06 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | NA | 7.00E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | NA | 1.43E-10 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | 1.01E-06 | NA | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | 1.71E-07 | 2.96E-16 | mr1739_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801775699 | NA | 2.43E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |