Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801772486:

Variant ID: vg0801772486 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1772486
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGAACGTGAACGTGAAATGCAATATATATATATATATATATGTTACTTTGCATTTATCCTAATACATATTTTTTGTATCTTGCAGAAAAGATGTGTTGT[T/C]
GGAGTCGTCCCTCAAGCCGGAGTGGAAGAGCTAGCCCTAGAAGGAATTCGTGCAGGCAAGTGACGTAATAATATAAATGATTGTTATATTTGTAATGCAA

Reverse complement sequence

TTGCATTACAAATATAACAATCATTTATATTATTACGTCACTTGCCTGCACGAATTCCTTCTAGGGCTAGCTCTTCCACTCCGGCTTGAGGGACGACTCC[A/G]
ACAACACATCTTTTCTGCAAGATACAAAAAATATGTATTAGGATAAATGCAAAGTAACATATATATATATATATATATTGCATTTCACGTTCACGTTCGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.80%	2.80%	9.88%	63.52%	NA
All Indica	2759	2.90%	0.00%	4.60%	92.50%	NA
All Japonica	1512	61.80%	8.20%	9.52%	20.44%	NA
Aus	269	2.20%	0.40%	67.66%	29.74%	NA
Indica I	595	2.50%	0.20%	1.51%	95.80%	NA
Indica II	465	2.20%	0.00%	1.29%	96.56%	NA
Indica III	913	2.20%	0.00%	7.12%	90.69%	NA
Indica Intermediate	786	4.30%	0.00%	5.98%	89.69%	NA
Temperate Japonica	767	96.20%	0.30%	0.78%	2.74%	NA
Tropical Japonica	504	13.50%	21.60%	21.43%	43.45%	NA
Japonica Intermediate	241	53.50%	5.40%	12.45%	28.63%	NA
VI/Aromatic	96	84.40%	0.00%	5.21%	10.42%	NA
Intermediate	90	28.90%	4.40%	10.00%	56.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801772486	T -> C	LOC_Os08g03730.1	upstream_gene_variant ; 917.0bp to feature; MODIFIER	silent_mutation	Average:8.073; most accessible tissue: Callus, score: 11.013	N	N	N	N
vg0801772486	T -> C	LOC_Os08g03740.1	upstream_gene_variant ; 3645.0bp to feature; MODIFIER	silent_mutation	Average:8.073; most accessible tissue: Callus, score: 11.013	N	N	N	N
vg0801772486	T -> C	LOC_Os08g03720.1	downstream_gene_variant ; 1664.0bp to feature; MODIFIER	silent_mutation	Average:8.073; most accessible tissue: Callus, score: 11.013	N	N	N	N
vg0801772486	T -> C	LOC_Os08g03720-LOC_Os08g03730	intergenic_region ; MODIFIER	silent_mutation	Average:8.073; most accessible tissue: Callus, score: 11.013	N	N	N	N
vg0801772486	T -> DEL	N	N	silent_mutation	Average:8.073; most accessible tissue: Callus, score: 11.013	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801772486	NA	1.11E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801772486	NA	4.71E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	1.76E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	1.21E-06	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	2.56E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	8.19E-07	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	2.31E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	1.40E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	1.82E-08	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	9.37E-09	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	6.74E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	2.59E-06	2.59E-06	mr1873	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	4.68E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	1.34E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	6.36E-06	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	6.09E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	4.59E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	1.57E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801772486	NA	4.30E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251