\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801744528:

Variant ID: vg0801744528 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 1744528
Reference Allele: GAlternative Allele: C,GTCCCT
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.05, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


ACACACCCAATCCCACCCACCTCCCCACTAGGCCACGTCACCCGCACGACGCGACGCCCCCTCCCCTTCCATTTCTCCTCCTCATCGCCCGGACCGTACG[G/C,GTCCCT]
CCACGCCACCCTCCGATCCCACGCCGCGCGCCGCGCCAGATCCGGCGCGCCGCCGCCGCTCGCCGGAGACGCACGCGGGGCGTGGCCCCCGCTACTGCGC

Reverse complement sequence

GCGCAGTAGCGGGGGCCACGCCCCGCGTGCGTCTCCGGCGAGCGGCGGCGGCGCGCCGGATCTGGCGCGGCGCGCGGCGTGGGATCGGAGGGTGGCGTGG[C/G,AGGGAC]
CGTACGGTCCGGGCGATGAGGAGGAGAAATGGAAGGGGAGGGGGCGTCGCGTCGTGCGGGTGACGTGGCCTAGTGGGGAGGTGGGTGGGATTGGGTGTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 17.80% 0.19% 0.00% GTCCCT: 1.25%
All Indica  2759 69.60% 29.90% 0.25% 0.00% GTCCCT: 0.25%
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 79.90% 0.40% 0.74% 0.00% GTCCCT: 18.96%
Indica I  595 71.40% 28.10% 0.50% 0.00% NA
Indica II  465 83.20% 16.80% 0.00% 0.00% NA
Indica III  913 64.80% 34.80% 0.00% 0.00% GTCCCT: 0.33%
Indica Intermediate  786 65.60% 33.30% 0.51% 0.00% GTCCCT: 0.51%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 0.00% 0.00% GTCCCT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801744528 G -> C LOC_Os08g03670.1 5_prime_UTR_variant ; 137.0bp to feature; MODIFIER silent_mutation Average:99.293; most accessible tissue: Callus, score: 99.835 N N N N
vg0801744528 G -> C LOC_Os08g03670.2 upstream_gene_variant ; 137.0bp to feature; MODIFIER silent_mutation Average:99.293; most accessible tissue: Callus, score: 99.835 N N N N
vg0801744528 G -> C LOC_Os08g03660.1 downstream_gene_variant ; 2681.0bp to feature; MODIFIER silent_mutation Average:99.293; most accessible tissue: Callus, score: 99.835 N N N N
vg0801744528 G -> GTCCCT LOC_Os08g03670.1 5_prime_UTR_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:99.293; most accessible tissue: Callus, score: 99.835 N N N N
vg0801744528 G -> GTCCCT LOC_Os08g03670.2 upstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:99.293; most accessible tissue: Callus, score: 99.835 N N N N
vg0801744528 G -> GTCCCT LOC_Os08g03660.1 downstream_gene_variant ; 2682.0bp to feature; MODIFIER silent_mutation Average:99.293; most accessible tissue: Callus, score: 99.835 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0801744528 G C -0.01 -0.04 -0.05 -0.04 -0.04 -0.03
vg0801744528 G GTCCC* 0.25 0.29 0.19 0.15 0.12 0.19

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801744528 3.27E-10 1.01E-21 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 1.96E-08 1.53E-17 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 NA 7.69E-07 mr1216_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 NA 3.65E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 NA 2.37E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 2.12E-06 1.56E-07 mr1472_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 5.69E-06 4.59E-07 mr1472_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 2.93E-07 2.73E-08 mr1483_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 8.92E-07 3.41E-08 mr1483_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 NA 3.78E-06 mr1504_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 NA 3.17E-07 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 6.97E-07 8.09E-16 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 NA 4.99E-13 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 NA 7.63E-07 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801744528 NA 8.49E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251