\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801674326:

Variant ID: vg0801674326 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 1674326
Reference Allele: TAlternative Allele: C,TAC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTTTGCTAAAATTTATACAGCCTATAGTAAGCCTCTGTTCGCTAGTTCTGGTTGGGAACCGATGCCCCATGCACGGAAAACGGAGCGGTCAATTAGCA[T/C,TAC]
GTGATTAATTAAGTATTAGTATTTTTTTCAAAAATAGATTAATTTGATTTTTTAAAGCAATTTTCATATAGAATATTTTTTTTTAAAAAAAACGCACCGT

Reverse complement sequence

ACGGTGCGTTTTTTTTAAAAAAAAATATTCTATATGAAAATTGCTTTAAAAAATCAAATTAATCTATTTTTGAAAAAAATACTAATACTTAATTAATCAC[A/G,GTA]
TGCTAATTGACCGCTCCGTTTTCCGTGCATGGGGCATCGGTTCCCAACCAGAACTAGCGAACAGAGGCTTACTATAGGCTGTATAAATTTTAGCAAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 34.60% 0.91% 0.00% TAC: 0.02%
All Indica  2759 96.40% 2.10% 1.45% 0.00% TAC: 0.04%
All Japonica  1512 3.60% 96.40% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 92.80% 4.40% 2.86% 0.00% NA
Indica II  465 96.10% 1.50% 2.15% 0.00% TAC: 0.22%
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 1.70% 1.65% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 3.60% 96.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801674326 T -> C LOC_Os08g03579.1 upstream_gene_variant ; 713.0bp to feature; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0801674326 T -> C LOC_Os08g03590.1 upstream_gene_variant ; 3514.0bp to feature; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0801674326 T -> C LOC_Os08g03579.2 upstream_gene_variant ; 707.0bp to feature; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0801674326 T -> C LOC_Os08g03570.1 downstream_gene_variant ; 2231.0bp to feature; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0801674326 T -> C LOC_Os08g03570-LOC_Os08g03579 intergenic_region ; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0801674326 T -> TAC LOC_Os08g03579.1 upstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0801674326 T -> TAC LOC_Os08g03590.1 upstream_gene_variant ; 3513.0bp to feature; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0801674326 T -> TAC LOC_Os08g03579.2 upstream_gene_variant ; 706.0bp to feature; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0801674326 T -> TAC LOC_Os08g03570.1 downstream_gene_variant ; 2232.0bp to feature; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0801674326 T -> TAC LOC_Os08g03570-LOC_Os08g03579 intergenic_region ; MODIFIER silent_mutation Average:67.987; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0801674326 T C 0.0 0.01 0.0 0.01 0.0 0.0
vg0801674326 T TAC -0.05 0.0 0.02 0.04 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801674326 8.74E-07 4.01E-08 mr1100 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 4.66E-28 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 3.91E-17 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 2.74E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 9.53E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 2.75E-07 3.23E-08 mr1613 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 1.64E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 4.24E-91 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 2.97E-06 2.97E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 1.64E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 7.18E-07 9.69E-11 mr1913 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 5.16E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 1.49E-27 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 5.29E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 4.95E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 2.35E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 1.55E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 7.37E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 1.25E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 8.55E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801674326 NA 8.99E-07 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251