\
| Variant ID: vg0801631583 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1631583 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 191. )
ACACATTTTGGTTTTCCATCGAATTATTATCCAATTCCATATGAATATCGATCTGATCGAACTTGTTTGATTAATCTATTGCAAAATACTTGGAGTCCTC[C/T]
GTGTCGAATGGACCAAATCTCCATATATATAGCCGCATCTACAAACCACTTTTTTATGAGAAAATGTGACACACACACACACTTTGCTTTCCCGTCAAAT
ATTTGACGGGAAAGCAAAGTGTGTGTGTGTGTCACATTTTCTCATAAAAAAGTGGTTTGTAGATGCGGCTATATATATGGAGATTTGGTCCATTCGACAC[G/A]
GAGGACTCCAAGTATTTTGCAATAGATTAATCAAACAAGTTCGATCAGATCGATATTCATATGGAATTGGATAATAATTCGATGGAAAACCAAAATGTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 94.50% | 5.30% | 0.20% | 0.00% | NA |
| Aus | 269 | 19.30% | 80.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 5.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 93.50% | 6.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801631583 | C -> T | LOC_Os08g03460.1 | upstream_gene_variant ; 4094.0bp to feature; MODIFIER | silent_mutation | Average:30.408; most accessible tissue: Callus, score: 50.335 | N | N | N | N |
| vg0801631583 | C -> T | LOC_Os08g03480.1 | upstream_gene_variant ; 655.0bp to feature; MODIFIER | silent_mutation | Average:30.408; most accessible tissue: Callus, score: 50.335 | N | N | N | N |
| vg0801631583 | C -> T | LOC_Os08g03490.1 | upstream_gene_variant ; 2920.0bp to feature; MODIFIER | silent_mutation | Average:30.408; most accessible tissue: Callus, score: 50.335 | N | N | N | N |
| vg0801631583 | C -> T | LOC_Os08g03470.1 | downstream_gene_variant ; 410.0bp to feature; MODIFIER | silent_mutation | Average:30.408; most accessible tissue: Callus, score: 50.335 | N | N | N | N |
| vg0801631583 | C -> T | LOC_Os08g03470-LOC_Os08g03480 | intergenic_region ; MODIFIER | silent_mutation | Average:30.408; most accessible tissue: Callus, score: 50.335 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801631583 | 5.45E-07 | NA | mr1037 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801631583 | 6.22E-06 | NA | mr1078 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801631583 | NA | 6.21E-06 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801631583 | NA | 2.67E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |