\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801631583:

Variant ID: vg0801631583 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1631583
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


ACACATTTTGGTTTTCCATCGAATTATTATCCAATTCCATATGAATATCGATCTGATCGAACTTGTTTGATTAATCTATTGCAAAATACTTGGAGTCCTC[C/T]
GTGTCGAATGGACCAAATCTCCATATATATAGCCGCATCTACAAACCACTTTTTTATGAGAAAATGTGACACACACACACACTTTGCTTTCCCGTCAAAT

Reverse complement sequence

ATTTGACGGGAAAGCAAAGTGTGTGTGTGTGTCACATTTTCTCATAAAAAAGTGGTTTGTAGATGCGGCTATATATATGGAGATTTGGTCCATTCGACAC[G/A]
GAGGACTCCAAGTATTTTGCAATAGATTAATCAAACAAGTTCGATCAGATCGATATTCATATGGAATTGGATAATAATTCGATGGAAAACCAAAATGTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.40% 0.08% 0.00% NA
All Indica  2759 98.40% 1.60% 0.04% 0.00% NA
All Japonica  1512 94.50% 5.30% 0.20% 0.00% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.30% 0.13% 0.00% NA
Temperate Japonica  767 94.30% 5.60% 0.13% 0.00% NA
Tropical Japonica  504 93.50% 6.30% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801631583 C -> T LOC_Os08g03460.1 upstream_gene_variant ; 4094.0bp to feature; MODIFIER silent_mutation Average:30.408; most accessible tissue: Callus, score: 50.335 N N N N
vg0801631583 C -> T LOC_Os08g03480.1 upstream_gene_variant ; 655.0bp to feature; MODIFIER silent_mutation Average:30.408; most accessible tissue: Callus, score: 50.335 N N N N
vg0801631583 C -> T LOC_Os08g03490.1 upstream_gene_variant ; 2920.0bp to feature; MODIFIER silent_mutation Average:30.408; most accessible tissue: Callus, score: 50.335 N N N N
vg0801631583 C -> T LOC_Os08g03470.1 downstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:30.408; most accessible tissue: Callus, score: 50.335 N N N N
vg0801631583 C -> T LOC_Os08g03470-LOC_Os08g03480 intergenic_region ; MODIFIER silent_mutation Average:30.408; most accessible tissue: Callus, score: 50.335 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801631583 5.45E-07 NA mr1037 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801631583 6.22E-06 NA mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801631583 NA 6.21E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801631583 NA 2.67E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251