\
| Variant ID: vg0801623800 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1623800 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATTTATGGTTAAGAACAAATTACTATAAACTTTATAAAATAATTTATGGTTGATGATAGAAAGGTGGTTGAGAGGTATAACAGTGAAAATTTTGAATGGA[A/G]
TGTGGATGGCGCCGGCGGCGTCCGTCACCGCCTCCACCGCACGTCGCGCCTGGTACTGCGCATCCACAAACCTCACACCACCACCATCACTAGCTCAACA
TGTTGAGCTAGTGATGGTGGTGGTGTGAGGTTTGTGGATGCGCAGTACCAGGCGCGACGTGCGGTGGAGGCGGTGACGGACGCCGCCGGCGCCATCCACA[T/C]
TCCATTCAAAATTTTCACTGTTATACCTCTCAACCACCTTTCTATCATCAACCATAAATTATTTTATAAAGTTTATAGTAATTTGTTCTTAACCATAAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.50% | 12.80% | 13.03% | 5.69% | NA |
| All Indica | 2759 | 68.90% | 0.30% | 21.60% | 9.21% | NA |
| All Japonica | 1512 | 60.10% | 38.40% | 0.86% | 0.66% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 48.70% | 0.00% | 41.51% | 9.75% | NA |
| Indica II | 465 | 53.30% | 0.20% | 28.17% | 18.28% | NA |
| Indica III | 913 | 88.50% | 0.50% | 6.57% | 4.38% | NA |
| Indica Intermediate | 786 | 70.50% | 0.40% | 20.10% | 9.03% | NA |
| Temperate Japonica | 767 | 94.40% | 3.40% | 1.17% | 1.04% | NA |
| Tropical Japonica | 504 | 17.70% | 81.90% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 39.40% | 58.90% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 15.60% | 7.78% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801623800 | A -> G | LOC_Os08g03470.1 | upstream_gene_variant ; 4704.0bp to feature; MODIFIER | silent_mutation | Average:68.707; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0801623800 | A -> G | LOC_Os08g03450.1 | downstream_gene_variant ; 2399.0bp to feature; MODIFIER | silent_mutation | Average:68.707; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0801623800 | A -> G | LOC_Os08g03460.1 | downstream_gene_variant ; 1710.0bp to feature; MODIFIER | silent_mutation | Average:68.707; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0801623800 | A -> G | LOC_Os08g03450-LOC_Os08g03460 | intergenic_region ; MODIFIER | silent_mutation | Average:68.707; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0801623800 | A -> DEL | N | N | silent_mutation | Average:68.707; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801623800 | NA | 4.82E-09 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 6.61E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | 2.80E-06 | 2.76E-17 | mr1916 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | 8.89E-06 | 6.67E-11 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 5.71E-21 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 3.32E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.61E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 2.83E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.66E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 7.05E-06 | mr1284_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.38E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 5.76E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 2.46E-11 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 4.93E-09 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 5.87E-06 | mr1374_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 5.82E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 2.13E-07 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 7.68E-08 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 3.22E-07 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 3.00E-07 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.18E-09 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 4.80E-07 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.53E-08 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 9.92E-08 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 3.59E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.16E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 7.12E-06 | mr1544_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.49E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 9.14E-08 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 4.94E-15 | mr1578_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 5.85E-06 | mr1621_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 2.78E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 6.40E-06 | mr1652_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 3.02E-06 | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.38E-10 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.11E-10 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.67E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 3.84E-07 | mr1764_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 2.75E-12 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 7.18E-14 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.71E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 4.41E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 5.46E-06 | mr1811_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.28E-07 | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 2.31E-06 | mr1833_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 1.01E-12 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 2.73E-18 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 7.75E-22 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 3.78E-09 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801623800 | NA | 2.51E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |