Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801569471:

Variant ID: vg0801569471 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1569471
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.23, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

ATATCAACTACTACTTCTAATTGTTTGACATGTGATAGTTAAAATGAATTTAGGAGTTAGACTTGTTTGGGTCACAATAATGTACCCAGCATGTAAGCTG[G/A]
CCACATCAGTTTGATATTTGGTGTGTTAAAACAAGTCTGAATAAATTGGCTAAAGACAGACATGTTTTCTCAACAAATTTTATTGGCCAGCATGGATCCA

Reverse complement sequence

TGGATCCATGCTGGCCAATAAAATTTGTTGAGAAAACATGTCTGTCTTTAGCCAATTTATTCAGACTTGTTTTAACACACCAAATATCAAACTGATGTGG[C/T]
CAGCTTACATGCTGGGTACATTATTGTGACCCAAACAAGTCTAACTCCTAAATTCATTTTAACTATCACATGTCAAACAATTAGAAGTAGTAGTTGATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.80%	14.10%	0.06%	0.00%	NA
All Indica	2759	91.20%	8.80%	0.07%	0.00%	NA
All Japonica	1512	96.00%	4.00%	0.00%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	85.40%	14.60%	0.00%	0.00%	NA
Indica Intermediate	786	86.60%	13.20%	0.13%	0.00%	NA
Temperate Japonica	767	96.10%	3.90%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	90.90%	9.10%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	89.60%	1.04%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801569471	G -> A	LOC_Os08g03350.1	downstream_gene_variant ; 2443.0bp to feature; MODIFIER	silent_mutation	Average:53.973; most accessible tissue: Callus, score: 73.693	N	N	N	N
vg0801569471	G -> A	LOC_Os08g03360.1	intron_variant ; MODIFIER	silent_mutation	Average:53.973; most accessible tissue: Callus, score: 73.693	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801569471	NA	5.11E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471	NA	2.28E-16	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471	NA	1.93E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471	NA	1.71E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471	NA	7.71E-11	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471	1.56E-06	NA	mr1499_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471	NA	4.03E-15	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471	NA	2.88E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471	NA	1.39E-15	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251