\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801569471:

Variant ID: vg0801569471 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1569471
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.23, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ATATCAACTACTACTTCTAATTGTTTGACATGTGATAGTTAAAATGAATTTAGGAGTTAGACTTGTTTGGGTCACAATAATGTACCCAGCATGTAAGCTG[G/A]
CCACATCAGTTTGATATTTGGTGTGTTAAAACAAGTCTGAATAAATTGGCTAAAGACAGACATGTTTTCTCAACAAATTTTATTGGCCAGCATGGATCCA

Reverse complement sequence

TGGATCCATGCTGGCCAATAAAATTTGTTGAGAAAACATGTCTGTCTTTAGCCAATTTATTCAGACTTGTTTTAACACACCAAATATCAAACTGATGTGG[C/T]
CAGCTTACATGCTGGGTACATTATTGTGACCCAAACAAGTCTAACTCCTAAATTCATTTTAACTATCACATGTCAAACAATTAGAAGTAGTAGTTGATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 14.10% 0.06% 0.00% NA
All Indica  2759 91.20% 8.80% 0.07% 0.00% NA
All Japonica  1512 96.00% 4.00% 0.00% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 85.40% 14.60% 0.00% 0.00% NA
Indica Intermediate  786 86.60% 13.20% 0.13% 0.00% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 89.60% 1.04% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801569471 G -> A LOC_Os08g03350.1 downstream_gene_variant ; 2443.0bp to feature; MODIFIER silent_mutation Average:53.973; most accessible tissue: Callus, score: 73.693 N N N N
vg0801569471 G -> A LOC_Os08g03360.1 intron_variant ; MODIFIER silent_mutation Average:53.973; most accessible tissue: Callus, score: 73.693 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801569471 NA 5.11E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471 NA 2.28E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471 NA 1.93E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471 NA 1.71E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471 NA 7.71E-11 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471 1.56E-06 NA mr1499_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471 NA 4.03E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471 NA 2.88E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801569471 NA 1.39E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251