\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801536655:

Variant ID: vg0801536655 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 1536655
Reference Allele: GAlternative Allele: C,GCAC
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAATATATCATGCAAATGACAAAAAATCGACCGACGTACTCCACTCCATCTCATCAAACCTCTCCGCCTTCTTCTCTCTCGCTCGCACGCACGCACGCA[G/C,GCAC]
GCAGTCGCGCGCCCCGTTTGAACTGGGCCAAGGCGACGACTAGGCTTCGATCGGCGAGCGAGCCCTCCGCTCGATCCCCCCGCATGCGATGCGATGCGAT

Reverse complement sequence

ATCGCATCGCATCGCATGCGGGGGGATCGAGCGGAGGGCTCGCTCGCCGATCGAAGCCTAGTCGTCGCCTTGGCCCAGTTCAAACGGGGCGCGCGACTGC[C/G,GTGC]
TGCGTGCGTGCGTGCGAGCGAGAGAGAAGAAGGCGGAGAGGTTTGATGAGATGGAGTGGAGTACGTCGGTCGATTTTTTGTCATTTGCATGATATATTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 15.20% 14.60% 29.79% GCAC: 6.37%
All Indica  2759 6.50% 17.80% 24.28% 49.04% GCAC: 2.46%
All Japonica  1512 91.90% 5.70% 0.53% 1.85% GCAC: 0.07%
Aus  269 0.00% 16.40% 1.49% 0.00% GCAC: 82.16%
Indica I  595 3.00% 2.40% 27.06% 67.39% GCAC: 0.17%
Indica II  465 5.40% 7.10% 7.31% 79.78% GCAC: 0.43%
Indica III  913 7.90% 28.60% 40.64% 20.15% GCAC: 2.74%
Indica Intermediate  786 8.00% 23.20% 13.23% 50.51% GCAC: 5.09%
Temperate Japonica  767 86.40% 10.00% 0.78% 2.74% NA
Tropical Japonica  504 98.80% 0.20% 0.20% 0.60% GCAC: 0.20%
Japonica Intermediate  241 94.60% 3.30% 0.41% 1.66% NA
VI/Aromatic  96 4.20% 89.60% 0.00% 3.12% GCAC: 3.12%
Intermediate  90 41.10% 14.40% 8.89% 26.67% GCAC: 8.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801536655 G -> C LOC_Os08g03310.1 5_prime_UTR_variant ; 89.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> C LOC_Os08g03310.4 5_prime_UTR_variant ; 313.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> C LOC_Os08g03310.5 5_prime_UTR_variant ; 313.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> C LOC_Os08g03310.6 5_prime_UTR_variant ; 313.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> C LOC_Os08g03310.3 5_prime_UTR_variant ; 313.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> C LOC_Os08g03300.1 upstream_gene_variant ; 3221.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> C LOC_Os08g03310.2 upstream_gene_variant ; 4.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> C LOC_Os08g03320.1 downstream_gene_variant ; 4138.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> DEL N N silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> GCAC LOC_Os08g03310.1 5_prime_UTR_variant ; 88.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> GCAC LOC_Os08g03310.4 5_prime_UTR_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> GCAC LOC_Os08g03310.5 5_prime_UTR_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> GCAC LOC_Os08g03310.6 5_prime_UTR_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> GCAC LOC_Os08g03310.3 5_prime_UTR_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> GCAC LOC_Os08g03300.1 upstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> GCAC LOC_Os08g03310.2 upstream_gene_variant ; 3.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N
vg0801536655 G -> GCAC LOC_Os08g03320.1 downstream_gene_variant ; 4137.0bp to feature; MODIFIER silent_mutation Average:92.44; most accessible tissue: Zhenshan97 flag leaf, score: 97.39 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0801536655 G C -0.04 -0.02 -0.02 -0.08 -0.04 -0.04
vg0801536655 G GCAC -0.39 -0.22 -0.11 -0.19 -0.18 -0.19

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801536655 NA 3.14E-48 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 2.24E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 9.56E-28 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 9.86E-06 7.50E-33 mr1309 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 4.80E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 1.61E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 2.75E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 9.31E-11 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 4.88E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 3.43E-06 mr1888 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 6.95E-15 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 8.27E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 2.62E-29 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 6.33E-27 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 6.77E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 1.44E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 3.39E-22 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801536655 NA 1.00E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251