\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801514213:

Variant ID: vg0801514213 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1514213
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATTTGAGGCCCAGAAAAATGAGAAAGAATAAAGAATAAATCAGCGGTGGAGCTCTACCTAAGTCGGAAGGAGATTTTTTTTAAAAAAAATGTTACTAA[A/G]
ATGTTATGTCATGATTTAGTGATTTATTTTTTATTAGGCGAAAAACTAAAATATTTAATGTCTAGAACACACGCTCAAATCATCGTCATGAGCTATAGCC

Reverse complement sequence

GGCTATAGCTCATGACGATGATTTGAGCGTGTGTTCTAGACATTAAATATTTTAGTTTTTCGCCTAATAAAAAATAAATCACTAAATCATGACATAACAT[T/C]
TTAGTAACATTTTTTTTAAAAAAAATCTCCTTCCGACTTAGGTAGAGCTCCACCGCTGATTTATTCTTTATTCTTTCTCATTTTTCTGGGCCTCAAATTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 6.50% 0.13% 5.56% NA
All Indica  2759 90.80% 2.50% 0.07% 6.63% NA
All Japonica  1512 99.50% 0.10% 0.07% 0.33% NA
Aus  269 16.40% 83.30% 0.00% 0.37% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 98.10% 0.60% 0.00% 1.29% NA
Indica III  913 84.10% 3.00% 0.11% 12.81% NA
Indica Intermediate  786 87.50% 4.80% 0.13% 7.51% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 19.80% 3.10% 2.08% 75.00% NA
Intermediate  90 87.80% 8.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801514213 A -> G LOC_Os08g03260.1 downstream_gene_variant ; 1221.0bp to feature; MODIFIER silent_mutation Average:54.37; most accessible tissue: Callus, score: 93.713 N N N N
vg0801514213 A -> G LOC_Os08g03270.1 downstream_gene_variant ; 1232.0bp to feature; MODIFIER silent_mutation Average:54.37; most accessible tissue: Callus, score: 93.713 N N N N
vg0801514213 A -> G LOC_Os08g03260-LOC_Os08g03270 intergenic_region ; MODIFIER silent_mutation Average:54.37; most accessible tissue: Callus, score: 93.713 N N N N
vg0801514213 A -> DEL N N silent_mutation Average:54.37; most accessible tissue: Callus, score: 93.713 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801514213 3.65E-06 NA mr1031 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 7.01E-06 NA mr1397 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 2.90E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 4.35E-10 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 1.89E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 1.77E-07 NA mr1630 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 3.60E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 8.97E-08 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 2.30E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 3.33E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 8.67E-17 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 7.81E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801514213 NA 4.49E-15 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251