Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801493126:

Variant ID: vg0801493126 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1493126
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGCTTCTAAAATTTTCGACAAGCTGAGAGTTGCTCCGGATACATATTTCAAGAACATCAAAGAAGCTGGAAGTATGGGAGCAAGTCTGGCGTTGGCGA[A/T]
GACTAAATCCCTTTATCCTAGAGTTGATATTGACACCATTGATGGCTTTGCAGACGGGACGAGCGAAGAAGCTGCTCTTGACCTCATCAGTGATGCGCAG

Reverse complement sequence

CTGCGCATCACTGATGAGGTCAAGAGCAGCTTCTTCGCTCGTCCCGTCTGCAAAGCCATCAATGGTGTCAATATCAACTCTAGGATAAAGGGATTTAGTC[T/A]
TCGCCAACGCCAGACTTGCTCCCATACTTCCAGCTTCTTTGATGTTCTTGAAATATGTATCCGGAGCAACTCTCAGCTTGTCGAAAATTTTAGAAGCATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.30%	34.30%	1.25%	8.13%	NA
All Indica	2759	82.50%	6.00%	2.03%	9.53%	NA
All Japonica	1512	6.80%	92.90%	0.00%	0.33%	NA
Aus	269	84.40%	1.50%	0.00%	14.13%	NA
Indica I	595	97.50%	2.20%	0.34%	0.00%	NA
Indica II	465	92.00%	3.40%	0.43%	4.09%	NA
Indica III	913	70.30%	7.00%	4.38%	18.29%	NA
Indica Intermediate	786	79.50%	9.20%	1.53%	9.80%	NA
Temperate Japonica	767	11.50%	88.30%	0.00%	0.26%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	95.00%	0.00%	1.24%	NA
VI/Aromatic	96	14.60%	8.30%	3.12%	73.96%	NA
Intermediate	90	47.80%	44.40%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801493126	A -> T	LOC_Os08g03210.1	missense_variant ; p.Lys544Met; MODERATE	nonsynonymous_codon ; K544M	Average:18.459; most accessible tissue: Minghui63 young leaf, score: 27.355	benign	-1.109	TOLERATED	1.00
vg0801493126	A -> DEL	LOC_Os08g03210.1	N	frameshift_variant	Average:18.459; most accessible tissue: Minghui63 young leaf, score: 27.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801493126	NA	1.03E-43	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	1.03E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	7.69E-44	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	4.22E-29	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	9.12E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	3.71E-24	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	5.19E-07	mr1888	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	6.38E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	2.95E-25	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	3.91E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	2.24E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	2.10E-19	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801493126	NA	2.25E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251