\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801405460:

Variant ID: vg0801405460 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1405460
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCGCCCTCTGGTAACCTCGATGGGTAGCTGGTGAGGAAGAAGGTCATCCCATCGCCCTTTTTGCTTCTATTTCCCGGGATGATGTTGAAGGAGAAGCGC[G/A]
TGGTGAAGCTGGCCACCTCGCCGGTGGCGGCGTCCCAGAGCTGCACTGGCGGTTTGTGGAACACCCGTCCGACGTTGTTGCCCACACTGTTCGCACTGAT

Reverse complement sequence

ATCAGTGCGAACAGTGTGGGCAACAACGTCGGACGGGTGTTCCACAAACCGCCAGTGCAGCTCTGGGACGCCGCCACCGGCGAGGTGGCCAGCTTCACCA[C/T]
GCGCTTCTCCTTCAACATCATCCCGGGAAATAGAAGCAAAAAGGGCGATGGGATGACCTTCTTCCTCACCAGCTACCCATCGAGGTTACCAGAGGGCGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 6.20% 4.99% 50.95% NA
All Indica  2759 20.50% 0.20% 5.84% 73.43% NA
All Japonica  1512 76.80% 17.90% 3.17% 2.12% NA
Aus  269 4.80% 0.40% 5.20% 89.59% NA
Indica I  595 13.60% 0.20% 9.08% 77.14% NA
Indica II  465 12.00% 0.20% 6.88% 80.86% NA
Indica III  913 29.70% 0.00% 2.96% 67.36% NA
Indica Intermediate  786 20.10% 0.50% 6.11% 73.28% NA
Temperate Japonica  767 93.40% 1.40% 2.74% 2.48% NA
Tropical Japonica  504 49.00% 46.40% 3.97% 0.60% NA
Japonica Intermediate  241 82.20% 10.80% 2.90% 4.15% NA
VI/Aromatic  96 14.60% 1.00% 3.12% 81.25% NA
Intermediate  90 41.10% 13.30% 11.11% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801405460 G -> A LOC_Os08g03100.1 missense_variant ; p.Thr94Met; MODERATE nonsynonymous_codon ; T94M Average:9.254; most accessible tissue: Callus, score: 30.039 benign 1.441 DELETERIOUS 0.00
vg0801405460 G -> DEL LOC_Os08g03100.1 N frameshift_variant Average:9.254; most accessible tissue: Callus, score: 30.039 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801405460 NA 1.78E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 1.54E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 3.98E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 2.97E-06 8.47E-24 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 6.08E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 1.82E-19 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 9.21E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 5.79E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 5.61E-30 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 1.39E-15 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 5.58E-06 1.52E-15 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 2.18E-19 mr1769 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 1.98E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 4.40E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 7.79E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 2.66E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 2.38E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 5.26E-06 6.14E-25 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 1.38E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 1.23E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 4.70E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 3.54E-19 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 2.54E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 3.23E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 1.04E-06 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 4.32E-10 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 2.54E-16 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 3.72E-18 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 7.48E-06 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 7.80E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801405460 NA 8.65E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251