\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801344289:

Variant ID: vg0801344289 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1344289
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAGTAGCACCTGAGGTCCTGGGTTCGACTCCCCGTGGGAGCGAATTTTCTAGGATTTAACGGCGTTGTGCTTTCAGTGGTAGGCGACGTACCCGTCGA[C/T]
AGCGAGGCGCCTGTGGTGACTTCGTCAATCTCTCCAGAATTTGCCGGCCAGTCTTCGAAGATGCTCATAGGGGTAGGGTTTGCGTGCGTATGTTTATATG

Reverse complement sequence

CATATAAACATACGCACGCAAACCCTACCCCTATGAGCATCTTCGAAGACTGGCCGGCAAATTCTGGAGAGATTGACGAAGTCACCACAGGCGCCTCGCT[G/A]
TCGACGGGTACGTCGCCTACCACTGAAAGCACAACGCCGTTAAATCCTAGAAAATTCGCTCCCACGGGGAGTCGAACCCAGGACCTCAGGTGCTACTGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 0.20% 2.50% 43.25% NA
All Indica  2759 34.20% 0.20% 3.70% 61.94% NA
All Japonica  1512 97.60% 0.10% 0.07% 2.25% NA
Aus  269 17.50% 1.10% 2.23% 79.18% NA
Indica I  595 39.70% 0.70% 2.35% 57.31% NA
Indica II  465 27.50% 0.00% 2.15% 70.32% NA
Indica III  913 34.10% 0.00% 4.60% 61.34% NA
Indica Intermediate  786 34.10% 0.10% 4.58% 61.20% NA
Temperate Japonica  767 97.10% 0.00% 0.00% 2.87% NA
Tropical Japonica  504 98.80% 0.20% 0.20% 0.79% NA
Japonica Intermediate  241 96.70% 0.00% 0.00% 3.32% NA
VI/Aromatic  96 28.10% 0.00% 7.29% 64.58% NA
Intermediate  90 68.90% 0.00% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801344289 C -> T LOC_Os08g03020.1 upstream_gene_variant ; 892.0bp to feature; MODIFIER silent_mutation Average:29.337; most accessible tissue: Callus, score: 55.645 N N N N
vg0801344289 C -> T LOC_Os08g03020-LOC_Os08g03030 intergenic_region ; MODIFIER silent_mutation Average:29.337; most accessible tissue: Callus, score: 55.645 N N N N
vg0801344289 C -> DEL N N silent_mutation Average:29.337; most accessible tissue: Callus, score: 55.645 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801344289 7.06E-06 7.08E-06 mr1311_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801344289 8.33E-07 8.33E-07 mr1311_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801344289 NA 7.74E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801344289 4.76E-06 4.76E-06 mr1337_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801344289 2.90E-06 2.90E-06 mr1374_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801344289 NA 9.32E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801344289 3.43E-06 3.42E-06 mr1688_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801344289 6.40E-06 6.40E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801344289 2.41E-06 2.41E-06 mr1843_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801344289 6.92E-06 6.92E-06 mr1847_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251