\
| Variant ID: vg0801344289 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1344289 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCAGTAGCACCTGAGGTCCTGGGTTCGACTCCCCGTGGGAGCGAATTTTCTAGGATTTAACGGCGTTGTGCTTTCAGTGGTAGGCGACGTACCCGTCGA[C/T]
AGCGAGGCGCCTGTGGTGACTTCGTCAATCTCTCCAGAATTTGCCGGCCAGTCTTCGAAGATGCTCATAGGGGTAGGGTTTGCGTGCGTATGTTTATATG
CATATAAACATACGCACGCAAACCCTACCCCTATGAGCATCTTCGAAGACTGGCCGGCAAATTCTGGAGAGATTGACGAAGTCACCACAGGCGCCTCGCT[G/A]
TCGACGGGTACGTCGCCTACCACTGAAAGCACAACGCCGTTAAATCCTAGAAAATTCGCTCCCACGGGGAGTCGAACCCAGGACCTCAGGTGCTACTGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.10% | 0.20% | 2.50% | 43.25% | NA |
| All Indica | 2759 | 34.20% | 0.20% | 3.70% | 61.94% | NA |
| All Japonica | 1512 | 97.60% | 0.10% | 0.07% | 2.25% | NA |
| Aus | 269 | 17.50% | 1.10% | 2.23% | 79.18% | NA |
| Indica I | 595 | 39.70% | 0.70% | 2.35% | 57.31% | NA |
| Indica II | 465 | 27.50% | 0.00% | 2.15% | 70.32% | NA |
| Indica III | 913 | 34.10% | 0.00% | 4.60% | 61.34% | NA |
| Indica Intermediate | 786 | 34.10% | 0.10% | 4.58% | 61.20% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.00% | 2.87% | NA |
| Tropical Japonica | 504 | 98.80% | 0.20% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 28.10% | 0.00% | 7.29% | 64.58% | NA |
| Intermediate | 90 | 68.90% | 0.00% | 2.22% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801344289 | C -> T | LOC_Os08g03020.1 | upstream_gene_variant ; 892.0bp to feature; MODIFIER | silent_mutation | Average:29.337; most accessible tissue: Callus, score: 55.645 | N | N | N | N |
| vg0801344289 | C -> T | LOC_Os08g03020-LOC_Os08g03030 | intergenic_region ; MODIFIER | silent_mutation | Average:29.337; most accessible tissue: Callus, score: 55.645 | N | N | N | N |
| vg0801344289 | C -> DEL | N | N | silent_mutation | Average:29.337; most accessible tissue: Callus, score: 55.645 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801344289 | 7.06E-06 | 7.08E-06 | mr1311_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801344289 | 8.33E-07 | 8.33E-07 | mr1311_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801344289 | NA | 7.74E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801344289 | 4.76E-06 | 4.76E-06 | mr1337_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801344289 | 2.90E-06 | 2.90E-06 | mr1374_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801344289 | NA | 9.32E-06 | mr1417_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801344289 | 3.43E-06 | 3.42E-06 | mr1688_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801344289 | 6.40E-06 | 6.40E-06 | mr1832_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801344289 | 2.41E-06 | 2.41E-06 | mr1843_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801344289 | 6.92E-06 | 6.92E-06 | mr1847_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |