\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801293540:

Variant ID: vg0801293540 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1293540
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ACGTGACAAAATATCATCAAATAGAACCAATCAACGAAACTTTCCAGATCTGATCTTTGAAGTATTAGAAAAGTTTTGGATGAATTAACTTGAACAAAAT[C/T]
GCAGCAAAATGAACAATCACAAGTTAATACCAAAACCAAATATAAACGTAAAACTTACGAAACCGGAATAGATCGTTAATGCCTTGATGATTGAATATGA

Reverse complement sequence

TCATATTCAATCATCAAGGCATTAACGATCTATTCCGGTTTCGTAAGTTTTACGTTTATATTTGGTTTTGGTATTAACTTGTGATTGTTCATTTTGCTGC[G/A]
ATTTTGTTCAAGTTAATTCATCCAAAACTTTTCTAATACTTCAAAGATCAGATCTGGAAAGTTTCGTTGATTGGTTCTATTTGATGATATTTTGTCACGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.70% 0.00% 0.00% NA
All Indica  2759 91.20% 8.80% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 16.70% 83.30% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 84.80% 15.20% 0.00% 0.00% NA
Indica Intermediate  786 88.00% 12.00% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801293540 C -> T LOC_Os08g02970.1 upstream_gene_variant ; 554.0bp to feature; MODIFIER silent_mutation Average:58.837; most accessible tissue: Callus, score: 75.885 N N N N
vg0801293540 C -> T LOC_Os08g02980.1 upstream_gene_variant ; 3459.0bp to feature; MODIFIER silent_mutation Average:58.837; most accessible tissue: Callus, score: 75.885 N N N N
vg0801293540 C -> T LOC_Os08g02970-LOC_Os08g02980 intergenic_region ; MODIFIER silent_mutation Average:58.837; most accessible tissue: Callus, score: 75.885 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801293540 NA 2.89E-10 mr1587 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801293540 NA 4.88E-08 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801293540 NA 9.79E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801293540 NA 2.09E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801293540 NA 7.41E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251