\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801276119:

Variant ID: vg0801276119 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1276119
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTAATCACAAAAGGGAACAGATCTAATCTCTAATCCCTAATTTTACTTAAAAAGTTAAAAAAGTTTCCGTCGTCCGTATATAATAAAAAACCATTATA[T/C]
GGTACAAGGGGCGGAAAAATCCAATTTTCTAATTGTGGTAACTACAACGATCCATATAAACATTATCATTAATATGGTTATGCATGAAAAGTGTATATTG

Reverse complement sequence

CAATATACACTTTTCATGCATAACCATATTAATGATAATGTTTATATGGATCGTTGTAGTTACCACAATTAGAAAATTGGATTTTTCCGCCCCTTGTACC[A/G]
TATAATGGTTTTTTATTATATACGGACGACGGAAACTTTTTTAACTTTTTAAGTAAAATTAGGGATTAGAGATTAGATCTGTTCCCTTTTGTGATTAGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 31.00% 0.38% 7.89% NA
All Indica  2759 70.80% 26.40% 0.25% 2.50% NA
All Japonica  1512 51.30% 43.70% 0.20% 4.89% NA
Aus  269 2.20% 15.60% 1.49% 80.67% NA
Indica I  595 66.90% 32.90% 0.17% 0.00% NA
Indica II  465 93.80% 5.40% 0.22% 0.65% NA
Indica III  913 58.60% 38.10% 0.11% 3.18% NA
Indica Intermediate  786 74.40% 20.40% 0.51% 4.71% NA
Temperate Japonica  767 60.00% 30.50% 0.26% 9.26% NA
Tropical Japonica  504 23.00% 76.80% 0.00% 0.20% NA
Japonica Intermediate  241 82.60% 16.20% 0.41% 0.83% NA
VI/Aromatic  96 93.80% 4.20% 0.00% 2.08% NA
Intermediate  90 48.90% 34.40% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801276119 T -> C LOC_Os08g02920.1 upstream_gene_variant ; 3485.0bp to feature; MODIFIER silent_mutation Average:16.517; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0801276119 T -> C LOC_Os08g02939.1 downstream_gene_variant ; 4067.0bp to feature; MODIFIER silent_mutation Average:16.517; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0801276119 T -> C LOC_Os08g02930.1 intron_variant ; MODIFIER silent_mutation Average:16.517; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0801276119 T -> DEL N N silent_mutation Average:16.517; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801276119 NA 3.33E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 1.05E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 3.19E-08 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 3.77E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 1.72E-12 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 5.24E-06 1.47E-08 mr1758 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 1.99E-06 mr1880 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 4.48E-06 mr1901 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 5.22E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 4.27E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 9.24E-09 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 2.28E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 4.61E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801276119 NA 1.23E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251