\
| Variant ID: vg0801228810 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1228810 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACAAAAGATACAATAGAGCCTCTTGTAATTCAGCTCAAAGTTGTGTGTTGGAAATGAGAGTGAGCTCCTCCTTTTATAGGCAGGTATGACGGTTACAGC[C/A]
TATGCGAAATGACCAAACTACCCTGGAACCGCCATTAGGATGTGATCAGGGCCGTCCATGCAAAATTTGACGATCAACGGCCAGCAAAACGGTTCGTCCG
CGGACGAACCGTTTTGCTGGCCGTTGATCGTCAAATTTTGCATGGACGGCCCTGATCACATCCTAATGGCGGTTCCAGGGTAGTTTGGTCATTTCGCATA[G/T]
GCTGTAACCGTCATACCTGCCTATAAAAGGAGGAGCTCACTCTCATTTCCAACACACAACTTTGAGCTGAATTACAAGAGGCTCTATTGTATCTTTTGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.50% | 0.19% | 0.25% | NA |
| All Indica | 2759 | 96.50% | 2.80% | 0.29% | 0.43% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 17.50% | 82.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.20% | 0.17% | 0.34% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.70% | 3.30% | 0.00% | 0.99% | NA |
| Indica Intermediate | 786 | 93.60% | 5.30% | 0.89% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801228810 | C -> A | LOC_Os08g02880.1 | downstream_gene_variant ; 1284.0bp to feature; MODIFIER | silent_mutation | Average:46.972; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0801228810 | C -> A | LOC_Os08g02870-LOC_Os08g02880 | intergenic_region ; MODIFIER | silent_mutation | Average:46.972; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0801228810 | C -> DEL | N | N | silent_mutation | Average:46.972; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801228810 | 7.21E-07 | NA | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 1.49E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 2.19E-07 | NA | mr1119 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 5.17E-08 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 2.48E-07 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 2.77E-06 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 2.48E-07 | NA | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | NA | 4.19E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | NA | 1.55E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | NA | 2.66E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 1.40E-06 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 2.62E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 1.72E-06 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | 2.29E-06 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | NA | 2.04E-16 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801228810 | NA | 1.30E-12 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |