\
| Variant ID: vg0801223131 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1223131 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAATCCGAGAATATTGTGAAAATGCACTGTTCATAAATGATTTATTTTTAATCGGAAACATTATCCAAAACCCACTGTGGTTGACATGTGGAACCGGTCC[C/T]
GGTTGACTTAGGGTCAAACCCAATTTCGATCTATATATCCTAAACTATTTTGCGGGTATAAATATTTTGTTATCATAAGTTTTTAATTTAATCTACCCGA
TCGGGTAGATTAAATTAAAAACTTATGATAACAAAATATTTATACCCGCAAAATAGTTTAGGATATATAGATCGAAATTGGGTTTGACCCTAAGTCAACC[G/A]
GGACCGGTTCCACATGTCAACCACAGTGGGTTTTGGATAATGTTTCCGATTAAAAATAAATCATTTATGAACAGTGCATTTTCACAATATTCTCGGATTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.50% | 12.70% | 0.38% | 6.45% | NA |
| All Indica | 2759 | 96.70% | 0.30% | 0.40% | 2.61% | NA |
| All Japonica | 1512 | 61.30% | 38.30% | 0.33% | 0.07% | NA |
| Aus | 269 | 17.10% | 0.00% | 0.74% | 82.16% | NA |
| Indica I | 595 | 98.80% | 0.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.22% | 0.43% | NA |
| Indica III | 913 | 96.60% | 0.00% | 0.11% | 3.29% | NA |
| Indica Intermediate | 786 | 93.90% | 0.40% | 0.64% | 5.09% | NA |
| Temperate Japonica | 767 | 36.40% | 63.10% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 5.60% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 71.80% | 27.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 78.90% | 11.10% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801223131 | C -> T | LOC_Os08g02870.1 | downstream_gene_variant ; 1545.0bp to feature; MODIFIER | silent_mutation | Average:29.315; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0801223131 | C -> T | LOC_Os08g02870-LOC_Os08g02880 | intergenic_region ; MODIFIER | silent_mutation | Average:29.315; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0801223131 | C -> DEL | N | N | silent_mutation | Average:29.315; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801223131 | NA | 3.23E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0801223131 | NA | 1.82E-14 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0801223131 | NA | 9.39E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0801223131 | NA | 4.52E-11 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0801223131 | NA | 3.13E-10 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 1.03E-08 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 4.67E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 3.39E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 3.22E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 5.48E-06 | mr1554 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 1.67E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 9.49E-07 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 1.75E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 2.21E-08 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 1.00E-08 | mr1942 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 3.94E-13 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 9.31E-09 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 8.24E-23 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 6.93E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 1.97E-11 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 1.23E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 2.31E-17 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 4.89E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 9.71E-16 | mr1031_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 1.67E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 1.53E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 3.19E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 6.15E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 4.45E-06 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 9.82E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 1.62E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801223131 | NA | 5.82E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |