RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0801223131:

Variant ID: vg0801223131 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1223131
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATCCGAGAATATTGTGAAAATGCACTGTTCATAAATGATTTATTTTTAATCGGAAACATTATCCAAAACCCACTGTGGTTGACATGTGGAACCGGTCC[C/T]
GGTTGACTTAGGGTCAAACCCAATTTCGATCTATATATCCTAAACTATTTTGCGGGTATAAATATTTTGTTATCATAAGTTTTTAATTTAATCTACCCGA

Reverse complement sequence

TCGGGTAGATTAAATTAAAAACTTATGATAACAAAATATTTATACCCGCAAAATAGTTTAGGATATATAGATCGAAATTGGGTTTGACCCTAAGTCAACC[G/A]
GGACCGGTTCCACATGTCAACCACAGTGGGTTTTGGATAATGTTTCCGATTAAAAATAAATCATTTATGAACAGTGCATTTTCACAATATTCTCGGATTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.50%	12.70%	0.38%	6.45%	NA
All Indica	2759	96.70%	0.30%	0.40%	2.61%	NA
All Japonica	1512	61.30%	38.30%	0.33%	0.07%	NA
Aus	269	17.10%	0.00%	0.74%	82.16%	NA
Indica I	595	98.80%	0.50%	0.67%	0.00%	NA
Indica II	465	98.90%	0.40%	0.22%	0.43%	NA
Indica III	913	96.60%	0.00%	0.11%	3.29%	NA
Indica Intermediate	786	93.90%	0.40%	0.64%	5.09%	NA
Temperate Japonica	767	36.40%	63.10%	0.52%	0.00%	NA
Tropical Japonica	504	94.20%	5.60%	0.00%	0.20%	NA
Japonica Intermediate	241	71.80%	27.80%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	1.00%	0.00%	2.08%	NA
Intermediate	90	78.90%	11.10%	0.00%	10.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801223131	C -> T	LOC_Os08g02870.1	downstream_gene_variant ; 1545.0bp to feature; MODIFIER	silent_mutation	Average:29.315; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0801223131	C -> T	LOC_Os08g02870-LOC_Os08g02880	intergenic_region ; MODIFIER	silent_mutation	Average:29.315; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0801223131	C -> DEL	N	N	silent_mutation	Average:29.315; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801223131	NA	3.23E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801223131	NA	1.82E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801223131	NA	9.39E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801223131	NA	4.52E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801223131	NA	3.13E-10	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131	NA	1.03E-08	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131	NA	4.67E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131	NA	3.39E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131	NA	3.22E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131	NA	5.48E-06	mr1554	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 32 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0801223131:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact