\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801223131:

Variant ID: vg0801223131 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1223131
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATCCGAGAATATTGTGAAAATGCACTGTTCATAAATGATTTATTTTTAATCGGAAACATTATCCAAAACCCACTGTGGTTGACATGTGGAACCGGTCC[C/T]
GGTTGACTTAGGGTCAAACCCAATTTCGATCTATATATCCTAAACTATTTTGCGGGTATAAATATTTTGTTATCATAAGTTTTTAATTTAATCTACCCGA

Reverse complement sequence

TCGGGTAGATTAAATTAAAAACTTATGATAACAAAATATTTATACCCGCAAAATAGTTTAGGATATATAGATCGAAATTGGGTTTGACCCTAAGTCAACC[G/A]
GGACCGGTTCCACATGTCAACCACAGTGGGTTTTGGATAATGTTTCCGATTAAAAATAAATCATTTATGAACAGTGCATTTTCACAATATTCTCGGATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.50% 12.70% 0.38% 6.45% NA
All Indica  2759 96.70% 0.30% 0.40% 2.61% NA
All Japonica  1512 61.30% 38.30% 0.33% 0.07% NA
Aus  269 17.10% 0.00% 0.74% 82.16% NA
Indica I  595 98.80% 0.50% 0.67% 0.00% NA
Indica II  465 98.90% 0.40% 0.22% 0.43% NA
Indica III  913 96.60% 0.00% 0.11% 3.29% NA
Indica Intermediate  786 93.90% 0.40% 0.64% 5.09% NA
Temperate Japonica  767 36.40% 63.10% 0.52% 0.00% NA
Tropical Japonica  504 94.20% 5.60% 0.00% 0.20% NA
Japonica Intermediate  241 71.80% 27.80% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 78.90% 11.10% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801223131 C -> T LOC_Os08g02870.1 downstream_gene_variant ; 1545.0bp to feature; MODIFIER silent_mutation Average:29.315; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0801223131 C -> T LOC_Os08g02870-LOC_Os08g02880 intergenic_region ; MODIFIER silent_mutation Average:29.315; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0801223131 C -> DEL N N silent_mutation Average:29.315; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801223131 NA 3.23E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801223131 NA 1.82E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801223131 NA 9.39E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801223131 NA 4.52E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801223131 NA 3.13E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 1.03E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 4.67E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 3.39E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 3.22E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 5.48E-06 mr1554 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 1.67E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 9.49E-07 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 1.75E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 2.21E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 1.00E-08 mr1942 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 3.94E-13 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 9.31E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 8.24E-23 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 6.93E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 1.97E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 1.23E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 2.31E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 4.89E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 9.71E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 1.67E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 1.53E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 3.19E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 6.15E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 4.45E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 9.82E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 1.62E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801223131 NA 5.82E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251