\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801178662:

Variant ID: vg0801178662 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1178662
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTAAAAAATGAACCCGAACAATAATTGTGTTCGATTTTTAAAATCCCAATAACAATAAAGAGAAAAAACAGTGGACGGTCCATAGAGGAGTATAATG[G/A]
CAGCGTTTGACGAGACTTCTAGAAATTATAAAAACGAAACCCAACGAGATAATAAACTGTAAAAACTATAAGATCCAATTTTTGAAGATACCAAGGAGAA

Reverse complement sequence

TTCTCCTTGGTATCTTCAAAAATTGGATCTTATAGTTTTTACAGTTTATTATCTCGTTGGGTTTCGTTTTTATAATTTCTAGAAGTCTCGTCAAACGCTG[C/T]
CATTATACTCCTCTATGGACCGTCCACTGTTTTTTCTCTTTATTGTTATTGGGATTTTAAAAATCGAACACAATTATTGTTCGGGTTCATTTTTTACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 13.80% 0.91% 21.98% NA
All Indica  2759 70.80% 0.50% 0.72% 28.02% NA
All Japonica  1512 58.30% 40.90% 0.33% 0.40% NA
Aus  269 5.60% 0.00% 6.32% 88.10% NA
Indica I  595 69.60% 1.20% 1.18% 28.07% NA
Indica II  465 95.10% 0.00% 0.00% 4.95% NA
Indica III  913 53.70% 0.10% 0.77% 45.45% NA
Indica Intermediate  786 77.10% 0.80% 0.76% 21.37% NA
Temperate Japonica  767 75.90% 23.70% 0.26% 0.13% NA
Tropical Japonica  504 22.60% 76.80% 0.00% 0.60% NA
Japonica Intermediate  241 77.20% 20.70% 1.24% 0.83% NA
VI/Aromatic  96 90.60% 2.10% 0.00% 7.29% NA
Intermediate  90 61.10% 20.00% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801178662 G -> A LOC_Os08g02790.1 upstream_gene_variant ; 2264.0bp to feature; MODIFIER silent_mutation Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 N N N N
vg0801178662 G -> A LOC_Os08g02800.1 upstream_gene_variant ; 658.0bp to feature; MODIFIER silent_mutation Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 N N N N
vg0801178662 G -> A LOC_Os08g02810.1 upstream_gene_variant ; 2772.0bp to feature; MODIFIER silent_mutation Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 N N N N
vg0801178662 G -> A LOC_Os08g02820.1 downstream_gene_variant ; 4069.0bp to feature; MODIFIER silent_mutation Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 N N N N
vg0801178662 G -> A LOC_Os08g02790-LOC_Os08g02800 intergenic_region ; MODIFIER silent_mutation Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 N N N N
vg0801178662 G -> DEL N N silent_mutation Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801178662 NA 2.51E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801178662 1.55E-08 NA mr1107_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801178662 NA 4.08E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801178662 NA 8.23E-09 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801178662 NA 1.28E-06 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251