\
| Variant ID: vg0801178662 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1178662 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAGTAAAAAATGAACCCGAACAATAATTGTGTTCGATTTTTAAAATCCCAATAACAATAAAGAGAAAAAACAGTGGACGGTCCATAGAGGAGTATAATG[G/A]
CAGCGTTTGACGAGACTTCTAGAAATTATAAAAACGAAACCCAACGAGATAATAAACTGTAAAAACTATAAGATCCAATTTTTGAAGATACCAAGGAGAA
TTCTCCTTGGTATCTTCAAAAATTGGATCTTATAGTTTTTACAGTTTATTATCTCGTTGGGTTTCGTTTTTATAATTTCTAGAAGTCTCGTCAAACGCTG[C/T]
CATTATACTCCTCTATGGACCGTCCACTGTTTTTTCTCTTTATTGTTATTGGGATTTTAAAAATCGAACACAATTATTGTTCGGGTTCATTTTTTACTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 13.80% | 0.91% | 21.98% | NA |
| All Indica | 2759 | 70.80% | 0.50% | 0.72% | 28.02% | NA |
| All Japonica | 1512 | 58.30% | 40.90% | 0.33% | 0.40% | NA |
| Aus | 269 | 5.60% | 0.00% | 6.32% | 88.10% | NA |
| Indica I | 595 | 69.60% | 1.20% | 1.18% | 28.07% | NA |
| Indica II | 465 | 95.10% | 0.00% | 0.00% | 4.95% | NA |
| Indica III | 913 | 53.70% | 0.10% | 0.77% | 45.45% | NA |
| Indica Intermediate | 786 | 77.10% | 0.80% | 0.76% | 21.37% | NA |
| Temperate Japonica | 767 | 75.90% | 23.70% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 22.60% | 76.80% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 77.20% | 20.70% | 1.24% | 0.83% | NA |
| VI/Aromatic | 96 | 90.60% | 2.10% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 61.10% | 20.00% | 1.11% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801178662 | G -> A | LOC_Os08g02790.1 | upstream_gene_variant ; 2264.0bp to feature; MODIFIER | silent_mutation | Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| vg0801178662 | G -> A | LOC_Os08g02800.1 | upstream_gene_variant ; 658.0bp to feature; MODIFIER | silent_mutation | Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| vg0801178662 | G -> A | LOC_Os08g02810.1 | upstream_gene_variant ; 2772.0bp to feature; MODIFIER | silent_mutation | Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| vg0801178662 | G -> A | LOC_Os08g02820.1 | downstream_gene_variant ; 4069.0bp to feature; MODIFIER | silent_mutation | Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| vg0801178662 | G -> A | LOC_Os08g02790-LOC_Os08g02800 | intergenic_region ; MODIFIER | silent_mutation | Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| vg0801178662 | G -> DEL | N | N | silent_mutation | Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801178662 | NA | 2.51E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801178662 | 1.55E-08 | NA | mr1107_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801178662 | NA | 4.08E-06 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801178662 | NA | 8.23E-09 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801178662 | NA | 1.28E-06 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |