\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801160172:

Variant ID: vg0801160172 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1160172
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AACAAACTTTTAAATTCAGGATTTAAAACTTTCAACTTATGTTTGAAAACTTGTAAGCCAAGATTTGAAACTTTCAACTCAATATTTTTTAAAATTTTCA[T/A]
CTCAGATTTTAAAATTCTCAAGTGAAGACCTAAAAACTTTTAATTCAGATTTGAAAACTTTCAACTCGGATTTGAAAACTTTCTGTTCAGTCTTGAAAAG

Reverse complement sequence

CTTTTCAAGACTGAACAGAAAGTTTTCAAATCCGAGTTGAAAGTTTTCAAATCTGAATTAAAAGTTTTTAGGTCTTCACTTGAGAATTTTAAAATCTGAG[A/T]
TGAAAATTTTAAAAAATATTGAGTTGAAAGTTTCAAATCTTGGCTTACAAGTTTTCAAACATAAGTTGAAAGTTTTAAATCCTGAATTTAAAAGTTTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 9.80% 17.35% 22.68% NA
All Indica  2759 27.00% 14.60% 26.06% 32.26% NA
All Japonica  1512 97.70% 0.10% 0.46% 1.79% NA
Aus  269 2.60% 21.20% 27.51% 48.70% NA
Indica I  595 14.30% 13.80% 29.24% 42.69% NA
Indica II  465 15.70% 11.60% 21.51% 51.18% NA
Indica III  913 33.70% 18.50% 29.90% 17.85% NA
Indica Intermediate  786 35.60% 12.60% 21.88% 29.90% NA
Temperate Japonica  767 97.00% 0.10% 0.78% 2.09% NA
Tropical Japonica  504 98.80% 0.00% 0.00% 1.19% NA
Japonica Intermediate  241 97.50% 0.00% 0.41% 2.07% NA
VI/Aromatic  96 88.50% 0.00% 5.21% 6.25% NA
Intermediate  90 62.20% 1.10% 16.67% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801160172 T -> A LOC_Os08g02770.1 upstream_gene_variant ; 4805.0bp to feature; MODIFIER silent_mutation Average:11.467; most accessible tissue: Callus, score: 41.046 N N N N
vg0801160172 T -> A LOC_Os08g02750.1 downstream_gene_variant ; 3744.0bp to feature; MODIFIER silent_mutation Average:11.467; most accessible tissue: Callus, score: 41.046 N N N N
vg0801160172 T -> A LOC_Os08g02760.1 downstream_gene_variant ; 2071.0bp to feature; MODIFIER silent_mutation Average:11.467; most accessible tissue: Callus, score: 41.046 N N N N
vg0801160172 T -> A LOC_Os08g02750-LOC_Os08g02760 intergenic_region ; MODIFIER silent_mutation Average:11.467; most accessible tissue: Callus, score: 41.046 N N N N
vg0801160172 T -> DEL N N silent_mutation Average:11.467; most accessible tissue: Callus, score: 41.046 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801160172 NA 2.38E-15 mr1216_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801160172 NA 5.95E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801160172 NA 2.88E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251