| Variant ID: vg0801145104 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1145104 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATACAAGATTAATTAAAATTCAGAATAAAAAATAAAATAATATCCAAAATTAGAAAATTAAAAGAGAGTTCAAGTAGGAATACAATTTTGAAACACATGA[A/T]
ATTCAAAAATAAAAAATATTAAAATATTAAAATAAAAAAGGTTTTTAAAAAATAAATTCTGAAATTATAAAAAGAAAAAAGATTTTAATTAGGAATACAA
TTGTATTCCTAATTAAAATCTTTTTTCTTTTTATAATTTCAGAATTTATTTTTTAAAAACCTTTTTTATTTTAATATTTTAATATTTTTTATTTTTGAAT[T/A]
TCATGTGTTTCAAAATTGTATTCCTACTTGAACTCTCTTTTAATTTTCTAATTTTGGATATTATTTTATTTTTTATTCTGAATTTTAATTAATCTTGTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 6.60% | 4.25% | 0.02% | NA |
| All Indica | 2759 | 90.30% | 2.80% | 6.92% | 0.04% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 15.20% | 84.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 90.10% | 0.00% | 9.92% | 0.00% | NA |
| Indica II | 465 | 95.90% | 0.60% | 3.23% | 0.22% | NA |
| Indica III | 913 | 92.00% | 3.50% | 4.49% | 0.00% | NA |
| Indica Intermediate | 786 | 85.00% | 5.30% | 9.67% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 8.90% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801145104 | A -> T | LOC_Os08g02730.1 | upstream_gene_variant ; 3839.0bp to feature; MODIFIER | silent_mutation | Average:14.962; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0801145104 | A -> T | LOC_Os08g02720-LOC_Os08g02730 | intergenic_region ; MODIFIER | silent_mutation | Average:14.962; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0801145104 | A -> DEL | N | N | silent_mutation | Average:14.962; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801145104 | NA | 6.78E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801145104 | 4.82E-06 | NA | mr1540 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801145104 | NA | 1.15E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801145104 | NA | 5.70E-07 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801145104 | NA | 7.40E-12 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |