\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801087393:

Variant ID: vg0801087393 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1087393
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.07, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTACAATTTGACTTCAGCTATTTTTTTCTTTCTGACATATATGTATTTACTATATTTTTTATCCAGTGTTTGTTTCACCTTGCTCCAAAATTTATTCA[A/T]
TTTTACTAGCTCCAAAATTTGTTCCTCTTTCTCTTTCTCTTTCTCTCTCTATTAGTAGGAGTAGCTGCTAAGCTGTGCCTGTAATCCTGTACTATCAGTA

Reverse complement sequence

TACTGATAGTACAGGATTACAGGCACAGCTTAGCAGCTACTCCTACTAATAGAGAGAGAAAGAGAAAGAGAAAGAGGAACAAATTTTGGAGCTAGTAAAA[T/A]
TGAATAAATTTTGGAGCAAGGTGAAACAAACACTGGATAAAAAATATAGTAAATACATATATGTCAGAAAGAAAAAAATAGCTGAAGTCAAATTGTACTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 32.40% 0.17% 0.00% NA
All Indica  2759 48.80% 51.10% 0.14% 0.00% NA
All Japonica  1512 95.50% 4.40% 0.13% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 34.60% 65.40% 0.00% 0.00% NA
Indica II  465 14.40% 85.40% 0.22% 0.00% NA
Indica III  913 76.10% 23.80% 0.11% 0.00% NA
Indica Intermediate  786 48.10% 51.70% 0.25% 0.00% NA
Temperate Japonica  767 92.40% 7.40% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801087393 A -> T LOC_Os08g02610.1 downstream_gene_variant ; 4833.0bp to feature; MODIFIER silent_mutation Average:88.137; most accessible tissue: Zhenshan97 panicle, score: 93.657 N N N N
vg0801087393 A -> T LOC_Os08g02630.1 downstream_gene_variant ; 2342.0bp to feature; MODIFIER silent_mutation Average:88.137; most accessible tissue: Zhenshan97 panicle, score: 93.657 N N N N
vg0801087393 A -> T LOC_Os08g02640.4 downstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:88.137; most accessible tissue: Zhenshan97 panicle, score: 93.657 N N N N
vg0801087393 A -> T LOC_Os08g02640.5 downstream_gene_variant ; 3760.0bp to feature; MODIFIER silent_mutation Average:88.137; most accessible tissue: Zhenshan97 panicle, score: 93.657 N N N N
vg0801087393 A -> T LOC_Os08g02640.2 downstream_gene_variant ; 3761.0bp to feature; MODIFIER silent_mutation Average:88.137; most accessible tissue: Zhenshan97 panicle, score: 93.657 N N N N
vg0801087393 A -> T LOC_Os08g02640.3 downstream_gene_variant ; 3761.0bp to feature; MODIFIER silent_mutation Average:88.137; most accessible tissue: Zhenshan97 panicle, score: 93.657 N N N N
vg0801087393 A -> T LOC_Os08g02610-LOC_Os08g02630 intergenic_region ; MODIFIER silent_mutation Average:88.137; most accessible tissue: Zhenshan97 panicle, score: 93.657 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0801087393 A T -0.01 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801087393 NA 9.59E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801087393 NA 3.54E-12 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801087393 NA 2.04E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801087393 4.32E-06 NA mr1397 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801087393 NA 2.15E-10 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801087393 NA 1.36E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801087393 NA 1.64E-07 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801087393 NA 1.26E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801087393 NA 4.07E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801087393 NA 1.31E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251