\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801055392:

Variant ID: vg0801055392 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1055392
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, G: 0.04, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AGGATGGCAATGGTTTGGGTATAGCACGGGTAGAGTAAAACCATACCCAACGCCGTCCGCCCGAACCCTACCCACTAAAGTTAGCGAGCAAAACTTTCCT[G/T,A]
GCCCACCCGAACCCTACCCACTAAAGTTAACGAGCAAAACTTTCCCTGCCTGTTCAGTGGGTATACAAGGGATCTCACATAAATAATAACTCAAAAGATA

Reverse complement sequence

TATCTTTTGAGTTATTATTTATGTGAGATCCCTTGTATACCCACTGAACAGGCAGGGAAAGTTTTGCTCGTTAACTTTAGTGGGTAGGGTTCGGGTGGGC[C/A,T]
AGGAAAGTTTTGCTCGCTAACTTTAGTGGGTAGGGTTCGGGCGGACGGCGTTGGGTATGGTTTTACTCTACCCGTGCTATACCCAAACCATTGCCATCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 15.50% 1.61% 0.19% A: 0.02%
All Indica  2759 84.10% 13.60% 1.99% 0.33% A: 0.04%
All Japonica  1512 77.80% 21.00% 1.19% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 87.60% 9.20% 3.19% 0.00% NA
Indica II  465 79.80% 16.80% 3.01% 0.43% NA
Indica III  913 83.20% 15.40% 0.88% 0.33% A: 0.11%
Indica Intermediate  786 85.00% 12.70% 1.78% 0.51% NA
Temperate Japonica  767 87.60% 11.20% 1.17% 0.00% NA
Tropical Japonica  504 55.40% 43.50% 1.19% 0.00% NA
Japonica Intermediate  241 93.40% 5.40% 1.24% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 81.10% 15.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801055392 G -> T LOC_Os08g02560.1 upstream_gene_variant ; 981.0bp to feature; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0801055392 G -> T LOC_Os08g02550.1 downstream_gene_variant ; 292.0bp to feature; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0801055392 G -> T LOC_Os08g02550-LOC_Os08g02560 intergenic_region ; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0801055392 G -> A LOC_Os08g02560.1 upstream_gene_variant ; 981.0bp to feature; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0801055392 G -> A LOC_Os08g02550.1 downstream_gene_variant ; 292.0bp to feature; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0801055392 G -> A LOC_Os08g02550-LOC_Os08g02560 intergenic_region ; MODIFIER silent_mutation Average:73.037; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0801055392 G -> DEL N N silent_mutation Average:73.037; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0801055392 G A -0.2 -0.14 -0.08 -0.13 -0.14 -0.16
vg0801055392 G T -0.21 -0.16 -0.09 -0.16 -0.15 -0.16

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801055392 6.61E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 NA 2.38E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 1.12E-07 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 7.04E-07 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 NA 4.14E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 4.67E-06 7.08E-06 mr1358 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 5.28E-06 NA mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 NA 3.85E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 4.66E-06 8.18E-10 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 3.49E-06 NA mr1436 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801055392 NA 8.16E-07 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251