\
| Variant ID: vg0801031318 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1031318 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCTTGGAGCGAGCAAATTAGTGGCTAGCGAGTGTGGATCATACCCACTCATTGCCGGATTGCTGCAATGTTTTTACTTTTAGGGGGTGTTTAGATTCAGG[T/C]
GTAAAGTTTTGGCGTATCACATCGGATATTATATAGGGTGTCGCATGGGATGTTCGAGCATTAATAAAAAAACTAATTACAGAATCCGTTAATAAACCGC
GCGGTTTATTAACGGATTCTGTAATTAGTTTTTTTATTAATGCTCGAACATCCCATGCGACACCCTATATAATATCCGATGTGATACGCCAAAACTTTAC[A/G]
CCTGAATCTAAACACCCCCTAAAAGTAAAAACATTGCAGCAATCCGGCAATGAGTGGGTATGATCCACACTCGCTAGCCACTAATTTGCTCGCTCCAAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 6.30% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.90% | 19.30% | 0.79% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 89.30% | 9.60% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 58.10% | 41.10% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801031318 | T -> C | LOC_Os08g02490-LOC_Os08g02520 | intergenic_region ; MODIFIER | silent_mutation | Average:44.118; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801031318 | 5.08E-06 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 2.35E-07 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | NA | 2.09E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 8.22E-07 | NA | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 9.14E-06 | NA | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 6.74E-11 | NA | mr1107 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | NA | 8.96E-07 | mr1107 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 4.48E-07 | NA | mr1204 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 2.30E-08 | NA | mr1226 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | NA | 5.77E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | NA | 7.79E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 3.88E-07 | NA | mr1437 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | NA | 6.34E-06 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 7.17E-06 | NA | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | NA | 5.61E-06 | mr1878 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 9.17E-06 | NA | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | 1.94E-07 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801031318 | NA | 2.37E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |