\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800947956:

Variant ID: vg0800947956 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 947956
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCTAACTAACGCTGTGTTTAGTTCCGAAATATTTCTTCAAACTTCTAACTTTTCCATCATATCTAAACTTTTCTACACACATAAACTTTCAACTTTTT[C/T]
ATCACATCGTTCCAATTTCAACCAAACCTTCAATTTTGGCGTGGAATAAACACAGCCAACAAGCCCCTGGTTAGTAATCTTCTTCTCTCGTTTTTCCCTT

Reverse complement sequence

AAGGGAAAAACGAGAGAAGAAGATTACTAACCAGGGGCTTGTTGGCTGTGTTTATTCCACGCCAAAATTGAAGGTTTGGTTGAAATTGGAACGATGTGAT[G/A]
AAAAAGTTGAAAGTTTATGTGTGTAGAAAAGTTTAGATATGATGGAAAAGTTAGAAGTTTGAAGAAATATTTCGGAACTAAACACAGCGTTAGTTAGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 6.20% 3.34% 0.00% NA
All Indica  2759 98.10% 0.10% 1.81% 0.00% NA
All Japonica  1512 74.50% 19.10% 6.42% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 95.60% 0.00% 4.37% 0.00% NA
Indica II  465 97.80% 0.40% 1.72% 0.00% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 98.20% 0.00% 1.78% 0.00% NA
Temperate Japonica  767 85.50% 6.90% 7.56% 0.00% NA
Tropical Japonica  504 49.20% 44.80% 5.95% 0.00% NA
Japonica Intermediate  241 92.10% 4.10% 3.73% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 88.90% 3.30% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800947956 C -> T LOC_Os08g02370.1 upstream_gene_variant ; 3549.0bp to feature; MODIFIER silent_mutation Average:85.934; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N
vg0800947956 C -> T LOC_Os08g02380.1 upstream_gene_variant ; 77.0bp to feature; MODIFIER silent_mutation Average:85.934; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N
vg0800947956 C -> T LOC_Os08g02380.2 upstream_gene_variant ; 77.0bp to feature; MODIFIER silent_mutation Average:85.934; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N
vg0800947956 C -> T LOC_Os08g02370-LOC_Os08g02380 intergenic_region ; MODIFIER silent_mutation Average:85.934; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800947956 C T 0.01 0.0 -0.01 0.02 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800947956 8.87E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 1.52E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 NA 2.04E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 6.31E-07 NA mr1085 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 1.53E-07 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 1.00E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 NA 4.38E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 NA 1.64E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 NA 7.97E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 NA 2.01E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 NA 1.66E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 NA 8.57E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800947956 NA 7.24E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251