\
| Variant ID: vg0800814630 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 814630 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATATTTATTTTAGAAGTTGAAATATTGTTAATGTGGGTCCAACGACATAAGGCGATAAAAAATAGCTATTTATTTTAAACGATTATAATAAAATTATTG[C/T]
TCCTAACTAAAAGATGATGAAAACATGAGAGACAATAGGAGGGGGAGGGCGTGAATGAGGGCGGAGGGGGTGGATGGTTTGGCGATGGTGTACGTATGTA
TACATACGTACACCATCGCCAAACCATCCACCCCCTCCGCCCTCATTCACGCCCTCCCCCTCCTATTGTCTCTCATGTTTTCATCATCTTTTAGTTAGGA[G/A]
CAATAATTTTATTATAATCGTTTAAAATAAATAGCTATTTTTTATCGCCTTATGTCGTTGGACCCACATTAACAATATTTCAACTTCTAAAATAAATATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.10% | 9.90% | 4.36% | 3.62% | NA |
| All Indica | 2759 | 90.40% | 0.50% | 2.97% | 6.05% | NA |
| All Japonica | 1512 | 63.00% | 29.10% | 7.74% | 0.13% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 76.80% | 0.70% | 5.04% | 17.48% | NA |
| Indica II | 465 | 92.30% | 1.10% | 3.23% | 3.44% | NA |
| Indica III | 913 | 97.30% | 0.10% | 0.77% | 1.86% | NA |
| Indica Intermediate | 786 | 91.70% | 0.60% | 3.82% | 3.82% | NA |
| Temperate Japonica | 767 | 39.00% | 50.20% | 10.69% | 0.13% | NA |
| Tropical Japonica | 504 | 92.50% | 4.20% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 14.10% | 7.47% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 13.30% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800814630 | C -> T | LOC_Os08g02260-LOC_Os08g02270 | intergenic_region ; MODIFIER | silent_mutation | Average:31.564; most accessible tissue: Zhenshan97 young leaf, score: 44.598 | N | N | N | N |
| vg0800814630 | C -> DEL | N | N | silent_mutation | Average:31.564; most accessible tissue: Zhenshan97 young leaf, score: 44.598 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800814630 | 5.23E-06 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800814630 | 3.45E-08 | NA | mr1354_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800814630 | NA | 4.78E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800814630 | 1.68E-07 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800814630 | NA | 4.33E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800814630 | 6.47E-10 | 6.03E-16 | mr1902_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800814630 | NA | 3.19E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |