\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800678290:

Variant ID: vg0800678290 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 678290
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, G: 0.28, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAAAATGGCAGAGAATCATTTGGGATTGCAAATTGTTGGGTAAAGATGCTTTGTGCAGCAAAAGAGAGAGGGGAGGAGAAAAAGAGGGGTTATTGACA[T/G]
GACACCAAATGGGCATCATGTTTTAATTAAGCTAGCAAAGCTAGCCATCTTTTTAACAAGACAAATGGTCGTAAAGCAAAATGGAGGAGGAATTTTGTAG

Reverse complement sequence

CTACAAAATTCCTCCTCCATTTTGCTTTACGACCATTTGTCTTGTTAAAAAGATGGCTAGCTTTGCTAGCTTAATTAAAACATGATGCCCATTTGGTGTC[A/C]
TGTCAATAACCCCTCTTTTTCTCCTCCCCTCTCTCTTTTGCTGCACAAAGCATCTTTACCCAACAATTTGCAATCCCAAATGATTCTCTGCCATTTTAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.20% 0.23% 0.00% NA
All Indica  2759 42.70% 56.90% 0.40% 0.00% NA
All Japonica  1512 96.60% 3.40% 0.00% 0.00% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 42.90% 56.60% 0.50% 0.00% NA
Indica II  465 20.20% 79.40% 0.43% 0.00% NA
Indica III  913 56.30% 43.30% 0.44% 0.00% NA
Indica Intermediate  786 40.10% 59.70% 0.25% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 93.10% 6.90% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800678290 T -> G LOC_Os08g02070.1 upstream_gene_variant ; 1068.0bp to feature; MODIFIER silent_mutation Average:49.727; most accessible tissue: Callus, score: 85.597 N N N N
vg0800678290 T -> G LOC_Os08g02060.1 downstream_gene_variant ; 3563.0bp to feature; MODIFIER silent_mutation Average:49.727; most accessible tissue: Callus, score: 85.597 N N N N
vg0800678290 T -> G LOC_Os08g02080.1 downstream_gene_variant ; 4309.0bp to feature; MODIFIER silent_mutation Average:49.727; most accessible tissue: Callus, score: 85.597 N N N N
vg0800678290 T -> G LOC_Os08g02080.2 downstream_gene_variant ; 4273.0bp to feature; MODIFIER silent_mutation Average:49.727; most accessible tissue: Callus, score: 85.597 N N N N
vg0800678290 T -> G LOC_Os08g02060-LOC_Os08g02070 intergenic_region ; MODIFIER silent_mutation Average:49.727; most accessible tissue: Callus, score: 85.597 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800678290 NA 6.23E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290 NA 7.57E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290 NA 7.97E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290 NA 3.81E-08 mr1791 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290 NA 1.26E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290 NA 1.81E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251