Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800678290:

Variant ID: vg0800678290 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 678290
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, G: 0.28, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TTTAAAATGGCAGAGAATCATTTGGGATTGCAAATTGTTGGGTAAAGATGCTTTGTGCAGCAAAAGAGAGAGGGGAGGAGAAAAAGAGGGGTTATTGACA[T/G]
GACACCAAATGGGCATCATGTTTTAATTAAGCTAGCAAAGCTAGCCATCTTTTTAACAAGACAAATGGTCGTAAAGCAAAATGGAGGAGGAATTTTGTAG

Reverse complement sequence

CTACAAAATTCCTCCTCCATTTTGCTTTACGACCATTTGTCTTGTTAAAAAGATGGCTAGCTTTGCTAGCTTAATTAAAACATGATGCCCATTTGGTGTC[A/C]
TGTCAATAACCCCTCTTTTTCTCCTCCCCTCTCTCTTTTGCTGCACAAAGCATCTTTACCCAACAATTTGCAATCCCAAATGATTCTCTGCCATTTTAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	40.20%	0.23%	0.00%	NA
All Indica	2759	42.70%	56.90%	0.40%	0.00%	NA
All Japonica	1512	96.60%	3.40%	0.00%	0.00%	NA
Aus	269	10.00%	90.00%	0.00%	0.00%	NA
Indica I	595	42.90%	56.60%	0.50%	0.00%	NA
Indica II	465	20.20%	79.40%	0.43%	0.00%	NA
Indica III	913	56.30%	43.30%	0.44%	0.00%	NA
Indica Intermediate	786	40.10%	59.70%	0.25%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	93.10%	6.90%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800678290	T -> G	LOC_Os08g02070.1	upstream_gene_variant ; 1068.0bp to feature; MODIFIER	silent_mutation	Average:49.727; most accessible tissue: Callus, score: 85.597	N	N	N	N
vg0800678290	T -> G	LOC_Os08g02060.1	downstream_gene_variant ; 3563.0bp to feature; MODIFIER	silent_mutation	Average:49.727; most accessible tissue: Callus, score: 85.597	N	N	N	N
vg0800678290	T -> G	LOC_Os08g02080.1	downstream_gene_variant ; 4309.0bp to feature; MODIFIER	silent_mutation	Average:49.727; most accessible tissue: Callus, score: 85.597	N	N	N	N
vg0800678290	T -> G	LOC_Os08g02080.2	downstream_gene_variant ; 4273.0bp to feature; MODIFIER	silent_mutation	Average:49.727; most accessible tissue: Callus, score: 85.597	N	N	N	N
vg0800678290	T -> G	LOC_Os08g02060-LOC_Os08g02070	intergenic_region ; MODIFIER	silent_mutation	Average:49.727; most accessible tissue: Callus, score: 85.597	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800678290	NA	6.23E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290	NA	7.57E-06	mr1564	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290	NA	7.97E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290	NA	3.81E-08	mr1791	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290	NA	1.26E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800678290	NA	1.81E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251