\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800670658:

Variant ID: vg0800670658 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 670658
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GCCACCCAAGTGCAGGGGCAGCATGGAGCCGAGATTTGGAAGCTAGCTGACGAGCTAGGTCGGGAAGCCATTGGAGGTTAACCGTGGAGAAGATGCAGTA[G/A]
GTAAGCCTGAAAATGATCACAACTTATCTCCTACAGCGTGCTCTTCTCTATGTTTGATGTTTGGCACAAATTCGCGCCGAGGGCGTATGACAAGAGAGCT

Reverse complement sequence

AGCTCTCTTGTCATACGCCCTCGGCGCGAATTTGTGCCAAACATCAAACATAGAGAAGAGCACGCTGTAGGAGATAAGTTGTGATCATTTTCAGGCTTAC[C/T]
TACTGCATCTTCTCCACGGTTAACCTCCAATGGCTTCCCGACCTAGCTCGTCAGCTAGCTTCCAAATCTCGGCTCCATGCTGCCCCTGCACTTGGGTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 28.70% 1.82% 10.52% NA
All Indica  2759 40.70% 47.60% 0.87% 10.80% NA
All Japonica  1512 97.40% 0.60% 0.20% 1.79% NA
Aus  269 12.30% 7.40% 20.45% 59.85% NA
Indica I  595 33.40% 65.50% 1.01% 0.00% NA
Indica II  465 64.50% 21.70% 0.43% 13.33% NA
Indica III  913 33.10% 49.60% 0.77% 16.54% NA
Indica Intermediate  786 41.10% 46.90% 1.15% 10.81% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 93.30% 1.00% 0.60% 5.16% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 0.00% 2.08% 1.04% NA
Intermediate  90 70.00% 16.70% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800670658 G -> A LOC_Os08g02050.1 upstream_gene_variant ; 3099.0bp to feature; MODIFIER silent_mutation Average:70.555; most accessible tissue: Zhenshan97 flower, score: 86.342 N N N N
vg0800670658 G -> A LOC_Os08g02060.1 upstream_gene_variant ; 602.0bp to feature; MODIFIER silent_mutation Average:70.555; most accessible tissue: Zhenshan97 flower, score: 86.342 N N N N
vg0800670658 G -> A LOC_Os08g02050-LOC_Os08g02060 intergenic_region ; MODIFIER silent_mutation Average:70.555; most accessible tissue: Zhenshan97 flower, score: 86.342 N N N N
vg0800670658 G -> DEL N N silent_mutation Average:70.555; most accessible tissue: Zhenshan97 flower, score: 86.342 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800670658 G A -0.06 -0.01 0.01 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800670658 NA 6.13E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670658 NA 8.06E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670658 NA 2.18E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670658 9.63E-07 9.63E-07 mr1811 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670658 NA 4.65E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670658 NA 1.01E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670658 NA 2.03E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670658 NA 1.69E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670658 NA 4.19E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251