Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0800670300:

Variant ID: vg0800670300 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 670300
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


AACATCACAAAGGTAAATTTTGTACAACATATATAATATTCCTCTACACATGAGCTCCAAAATATATGGTACATGTTATTTGGTGATGAATTTGATATGT[A/G]
GTGAACGAATGCTTCCAGCACCGATGATATTGTTCCTAATCATATCTTGCTCCATGTCTGTCCGGGGAAAGGACAATGGCGTCACAGTACTCGCAAGGCT

Reverse complement sequence

AGCCTTGCGAGTACTGTGACGCCATTGTCCTTTCCCCGGACAGACATGGAGCAAGATATGATTAGGAACAATATCATCGGTGCTGGAAGCATTCGTTCAC[T/C]
ACATATCAAATTCATCACCAAATAACATGTACCATATATTTTGGAGCTCATGTGTAGAGGAATATTATATATGTTGTACAAAATTTACCTTTGTGATGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 11.80% 0.04% 0.00% NA
All Indica  2759 80.70% 19.20% 0.07% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 76.80% 23.00% 0.17% 0.00% NA
Indica II  465 48.20% 51.80% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 80.50% 19.30% 0.13% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800670300 A -> G LOC_Os08g02050.1 upstream_gene_variant ; 2741.0bp to feature; MODIFIER silent_mutation Average:81.397; most accessible tissue: Callus, score: 93.247 N N N N
vg0800670300 A -> G LOC_Os08g02060.1 upstream_gene_variant ; 960.0bp to feature; MODIFIER silent_mutation Average:81.397; most accessible tissue: Callus, score: 93.247 N N N N
vg0800670300 A -> G LOC_Os08g02050-LOC_Os08g02060 intergenic_region ; MODIFIER silent_mutation Average:81.397; most accessible tissue: Callus, score: 93.247 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800670300 A G 0.02 0.01 0.01 -0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800670300 8.18E-06 8.17E-06 mr1040 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 9.31E-06 NA mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 6.18E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 4.60E-08 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 5.00E-08 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 2.19E-08 NA mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 4.96E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 9.70E-06 NA mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 8.58E-08 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 2.07E-12 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 6.05E-08 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 4.85E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 4.59E-06 NA mr1728 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 1.40E-06 NA mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 1.25E-06 2.00E-07 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 2.67E-06 mr1771 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 5.71E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 2.39E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 2.20E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800670300 NA 2.84E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251