\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800651704:

Variant ID: vg0800651704 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 651704
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.33, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTTCCATCACATCACATCACATCCAAAACTTTCCTACACACATAAACTCCTAACTTTTTTCCAAACTATCAACTTTCTCCAAACTTCTCCCTAATTT[C/T]
ATAAACTAAACACAACCTATGAGATAGGAGTACATGATATTGACAACAATGGGCAGTAAGTACTCCCTTCGTCCTAAAATATAACACCTTTTAGGTGGAT

Reverse complement sequence

ATCCACCTAAAAGGTGTTATATTTTAGGACGAAGGGAGTACTTACTGCCCATTGTTGTCAATATCATGTACTCCTATCTCATAGGTTGTGTTTAGTTTAT[G/A]
AAATTAGGGAGAAGTTTGGAGAAAGTTGATAGTTTGGAAAAAAGTTAGGAGTTTATGTGTGTAGGAAAGTTTTGGATGTGATGTGATGTGATGGAAAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 48.60% 0.06% 0.00% NA
All Indica  2759 74.50% 25.40% 0.07% 0.00% NA
All Japonica  1512 2.60% 97.40% 0.00% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 85.50% 14.30% 0.17% 0.00% NA
Indica II  465 43.40% 56.60% 0.00% 0.00% NA
Indica III  913 87.60% 12.40% 0.00% 0.00% NA
Indica Intermediate  786 69.20% 30.70% 0.13% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 34.40% 64.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800651704 C -> T LOC_Os08g02010.1 upstream_gene_variant ; 3160.0bp to feature; MODIFIER silent_mutation Average:63.176; most accessible tissue: Zhenshan97 root, score: 96.334 N N N N
vg0800651704 C -> T LOC_Os08g02020.1 downstream_gene_variant ; 953.0bp to feature; MODIFIER silent_mutation Average:63.176; most accessible tissue: Zhenshan97 root, score: 96.334 N N N N
vg0800651704 C -> T LOC_Os08g02030.1 downstream_gene_variant ; 4044.0bp to feature; MODIFIER silent_mutation Average:63.176; most accessible tissue: Zhenshan97 root, score: 96.334 N N N N
vg0800651704 C -> T LOC_Os08g02010-LOC_Os08g02020 intergenic_region ; MODIFIER silent_mutation Average:63.176; most accessible tissue: Zhenshan97 root, score: 96.334 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800651704 C T 0.14 0.02 0.0 0.02 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800651704 NA 1.34E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 4.60E-15 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 7.35E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 3.20E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 1.16E-06 NA mr1138 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 8.01E-07 NA mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 1.20E-16 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 3.64E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 1.32E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 1.86E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 1.38E-16 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 2.40E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 5.50E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 1.15E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 4.46E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 1.77E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 3.31E-06 NA mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 1.65E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 2.29E-26 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 5.54E-08 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 3.84E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 2.65E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800651704 NA 8.71E-22 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251