Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800648461:

Variant ID: vg0800648461 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 648461
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGAGTAAAGTAAAACCATGAAAACCGGAGCTAAGCTGTATGGCATCTCTGGTAATCGGCGCAGTATATATGCCATCTTTGGATGCCACCCTGCTTCCA[A/C]
AGTTGTACTTCTCTCGGGAAATTAACTTACTTTCTCTCGGCCGGCAAGTTGTACATCCCATCCCGGCAAGCAAGGGCCTCCATCATGTCATCGATGAGAG

Reverse complement sequence

CTCTCATCGATGACATGATGGAGGCCCTTGCTTGCCGGGATGGGATGTACAACTTGCCGGCCGAGAGAAAGTAAGTTAATTTCCCGAGAGAAGTACAACT[T/G]
TGGAAGCAGGGTGGCATCCAAAGATGGCATATATACTGCGCCGATTACCAGAGATGCCATACAGCTTAGCTCCGGTTTTCATGGTTTTACTTTACTCTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 45.40% 0.11% 0.00% NA
All Indica  2759 78.50% 21.40% 0.07% 0.00% NA
All Japonica  1512 2.80% 97.10% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.70% 14.30% 0.00% 0.00% NA
Indica II  465 46.20% 53.80% 0.00% 0.00% NA
Indica III  913 93.80% 6.20% 0.00% 0.00% NA
Indica Intermediate  786 74.40% 25.30% 0.25% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 7.30% 92.30% 0.40% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800648461 A -> C LOC_Os08g02000.1 downstream_gene_variant ; 4748.0bp to feature; MODIFIER silent_mutation Average:82.352; most accessible tissue: Callus, score: 97.299 N N N N
vg0800648461 A -> C LOC_Os08g02020.1 downstream_gene_variant ; 4196.0bp to feature; MODIFIER silent_mutation Average:82.352; most accessible tissue: Callus, score: 97.299 N N N N
vg0800648461 A -> C LOC_Os08g02010.1 intron_variant ; MODIFIER silent_mutation Average:82.352; most accessible tissue: Callus, score: 97.299 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800648461 A C 0.05 0.05 0.06 0.05 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800648461 NA 1.16E-14 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 6.84E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 1.72E-06 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 6.37E-06 NA mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 3.23E-16 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 2.28E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 1.62E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 4.79E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 2.56E-16 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 7.57E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 1.47E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 4.88E-07 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 5.85E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 2.80E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 3.78E-07 NA mr1138_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 6.48E-06 NA mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 1.20E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 1.29E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 7.34E-28 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 8.51E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 1.22E-08 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 3.93E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 1.97E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 1.12E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800648461 NA 6.89E-23 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251