\
| Variant ID: vg0800647630 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 647630 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )
TGAGAAGTAGATGAAACTATAGACAAACTTTCTAATTTGTGGTCCTTAATGTGCCGTTCCATTCATTAATTTTGTTATATGTGGTACTAGCATGTGAATA[C/T]
TATAAAGATGTGAAAATTATAAATATGTGACATACTTATCATTAGTTCTATATTAATGTTTTTGTTACATCCGATTTACACCCAATGATTATTTAACATC
GATGTTAAATAATCATTGGGTGTAAATCGGATGTAACAAAAACATTAATATAGAACTAATGATAAGTATGTCACATATTTATAATTTTCACATCTTTATA[G/A]
TATTCACATGCTAGTACCACATATAACAAAATTAATGAATGGAACGGCACATTAAGGACCACAAATTAGAAAGTTTGTCTATAGTTTCATCTACTTCTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.40% | 3.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 93.90% | 6.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.70% | 16.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 4.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800647630 | C -> T | LOC_Os08g02000.1 | downstream_gene_variant ; 3917.0bp to feature; MODIFIER | silent_mutation | Average:34.801; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0800647630 | C -> T | LOC_Os08g02010.1 | downstream_gene_variant ; 603.0bp to feature; MODIFIER | silent_mutation | Average:34.801; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0800647630 | C -> T | LOC_Os08g02000-LOC_Os08g02010 | intergenic_region ; MODIFIER | silent_mutation | Average:34.801; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800647630 | NA | 1.42E-07 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 5.15E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 3.28E-07 | mr1204_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 7.89E-08 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 5.07E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 9.42E-06 | mr1545_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 3.48E-07 | mr1550_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 4.44E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 6.76E-06 | mr1714_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 6.35E-06 | mr1722_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 5.99E-10 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 7.19E-08 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 7.61E-06 | mr1754_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 1.50E-09 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | NA | 2.88E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | 8.26E-06 | NA | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800647630 | 2.99E-06 | 3.34E-06 | mr1980_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |