\
| Variant ID: vg0800596392 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 596392 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 222. )
AGATTCAATTGAATATATTTTACAGTAAATTTATTCAGTATTAAAAATGTTACTATATTTCTCTATAATCTAGTCAAACTTATGAAATTTTACTTCAAAC[A/G]
AAAGAAAACAAAACACCTTACACTATGAGTACTGAAGCAGAGAGTGACTCGGAGAGTACCAAAATTTTGTTAGTAATAAGGTGTTTTGACATGATATACG
CGTATATCATGTCAAAACACCTTATTACTAACAAAATTTTGGTACTCTCCGAGTCACTCTCTGCTTCAGTACTCATAGTGTAAGGTGTTTTGTTTTCTTT[T/C]
GTTTGAAGTAAAATTTCATAAGTTTGACTAGATTATAGAGAAATATAGTAACATTTTTAATACTGAATAAATTTACTGTAAAATATATTCAATTGAATCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.40% | 16.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 80.90% | 19.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.20% | 11.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800596392 | A -> G | LOC_Os08g01950.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800596392 | 2.22E-10 | NA | mr1138 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | 1.10E-10 | NA | mr1138 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | NA | 7.59E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | NA | 6.75E-10 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | NA | 2.06E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | NA | 3.75E-08 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | NA | 6.93E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | 2.24E-10 | NA | mr1138_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | 2.62E-09 | NA | mr1138_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | 3.71E-06 | 1.62E-06 | mr1735_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | NA | 3.03E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800596392 | NA | 4.57E-08 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |