Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800559145:

Variant ID: vg0800559145 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 559145
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TGTACTCCTTCTGTCCTATATTAATATTAGTTGTCTTCCTACCATTTAAATTTTGTCCCATAATACTTATCACTAGCAGTACTACTTATCCCATTAATCA[C/T]
ATCTTATTCAAATTTCTCTCCATTCTCCCCCTCAACCACCCATCCATCCTCATCCATAAATTACTTTATAAGGGTATTATAGTCTTTTTGAACTTTTTTT

Reverse complement sequence

AAAAAAAGTTCAAAAAGACTATAATACCCTTATAAAGTAATTTATGGATGAGGATGGATGGGTGGTTGAGGGGGAGAATGGAGAGAAATTTGAATAAGAT[G/A]
TGATTAATGGGATAAGTAGTACTGCTAGTGATAAGTATTATGGGACAAAATTTAAATGGTAGGAAGACAACTAATATTAATATAGGACAGAAGGAGTACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	34.90%	0.89%	0.00%	NA
All Indica	2759	78.70%	20.90%	0.47%	0.00%	NA
All Japonica	1512	32.70%	65.50%	1.79%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	84.90%	14.10%	1.01%	0.00%	NA
Indica II	465	48.40%	51.60%	0.00%	0.00%	NA
Indica III	913	95.00%	5.00%	0.00%	0.00%	NA
Indica Intermediate	786	72.90%	26.20%	0.89%	0.00%	NA
Temperate Japonica	767	55.40%	42.50%	2.09%	0.00%	NA
Tropical Japonica	504	4.00%	94.00%	1.98%	0.00%	NA
Japonica Intermediate	241	20.70%	78.80%	0.41%	0.00%	NA
VI/Aromatic	96	67.70%	32.30%	0.00%	0.00%	NA
Intermediate	90	55.60%	42.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800559145	C -> T	LOC_Os08g01910.1	upstream_gene_variant ; 520.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800559145	C -> T	LOC_Os08g01900.1	downstream_gene_variant ; 2214.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800559145	C -> T	LOC_Os08g01920.1	downstream_gene_variant ; 1856.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800559145	C -> T	LOC_Os08g01910-LOC_Os08g01920	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0800559145	C	T	0.03	-0.01	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800559145	NA	9.97E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	2.73E-06	NA	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	7.11E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	1.02E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	1.52E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	9.30E-06	mr1296_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	3.32E-08	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	1.52E-06	mr1380_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	7.97E-07	mr1561_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	1.42E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	3.15E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	NA	6.56E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145	2.30E-06	1.35E-08	mr1996_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251