\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800559145:

Variant ID: vg0800559145 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 559145
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TGTACTCCTTCTGTCCTATATTAATATTAGTTGTCTTCCTACCATTTAAATTTTGTCCCATAATACTTATCACTAGCAGTACTACTTATCCCATTAATCA[C/T]
ATCTTATTCAAATTTCTCTCCATTCTCCCCCTCAACCACCCATCCATCCTCATCCATAAATTACTTTATAAGGGTATTATAGTCTTTTTGAACTTTTTTT

Reverse complement sequence

AAAAAAAGTTCAAAAAGACTATAATACCCTTATAAAGTAATTTATGGATGAGGATGGATGGGTGGTTGAGGGGGAGAATGGAGAGAAATTTGAATAAGAT[G/A]
TGATTAATGGGATAAGTAGTACTGCTAGTGATAAGTATTATGGGACAAAATTTAAATGGTAGGAAGACAACTAATATTAATATAGGACAGAAGGAGTACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 34.90% 0.89% 0.00% NA
All Indica  2759 78.70% 20.90% 0.47% 0.00% NA
All Japonica  1512 32.70% 65.50% 1.79% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 84.90% 14.10% 1.01% 0.00% NA
Indica II  465 48.40% 51.60% 0.00% 0.00% NA
Indica III  913 95.00% 5.00% 0.00% 0.00% NA
Indica Intermediate  786 72.90% 26.20% 0.89% 0.00% NA
Temperate Japonica  767 55.40% 42.50% 2.09% 0.00% NA
Tropical Japonica  504 4.00% 94.00% 1.98% 0.00% NA
Japonica Intermediate  241 20.70% 78.80% 0.41% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800559145 C -> T LOC_Os08g01910.1 upstream_gene_variant ; 520.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800559145 C -> T LOC_Os08g01900.1 downstream_gene_variant ; 2214.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800559145 C -> T LOC_Os08g01920.1 downstream_gene_variant ; 1856.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800559145 C -> T LOC_Os08g01910-LOC_Os08g01920 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800559145 C T 0.03 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800559145 NA 9.97E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 2.73E-06 NA mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 7.11E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 1.02E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 1.52E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 9.30E-06 mr1296_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 3.32E-08 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 1.52E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 7.97E-07 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 1.42E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 3.15E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 NA 6.56E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800559145 2.30E-06 1.35E-08 mr1996_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251