\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800542399:

Variant ID: vg0800542399 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 542399
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTATACAATTCATATATAACTAGAGACATACTCCCTCTTTCCCCTAGTAAGCGCAGTTGTGGGTTTTACTTCCCAACGTTTAATCGTTCGTCTTATTT[G/A]
AAATTTTTTTTATGACTACTATTTTTATTGTTATTGGATGATAAAATATGATTAGTAATTTATGCATAACTTAATTTTTAATTTTTTTTATATTTTTTCA

Reverse complement sequence

TGAAAAAATATAAAAAAAATTAAAAATTAAGTTATGCATAAATTACTAATCATATTTTATCATCCAATAACAATAAAAATAGTAGTCATAAAAAAAATTT[C/T]
AAATAAGACGAACGATTAAACGTTGGGAAGTAAAACCCACAACTGCGCTTACTAGGGGAAAGAGGGAGTATGTCTCTAGTTATATATGAATTGTATAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 37.70% 7.36% 1.16% NA
All Indica  2759 31.00% 55.20% 11.89% 1.96% NA
All Japonica  1512 98.40% 0.80% 0.73% 0.07% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 21.70% 67.40% 9.92% 1.01% NA
Indica II  465 18.90% 38.50% 35.48% 7.10% NA
Indica III  913 39.50% 60.20% 0.22% 0.00% NA
Indica Intermediate  786 35.10% 50.00% 12.98% 1.91% NA
Temperate Japonica  767 98.80% 0.10% 0.91% 0.13% NA
Tropical Japonica  504 98.00% 1.60% 0.40% 0.00% NA
Japonica Intermediate  241 97.90% 1.20% 0.83% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 65.60% 24.40% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800542399 G -> A LOC_Os08g01880.1 upstream_gene_variant ; 782.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800542399 G -> A LOC_Os08g01870.1 downstream_gene_variant ; 3367.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800542399 G -> A LOC_Os08g01890.1 downstream_gene_variant ; 4373.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800542399 G -> A LOC_Os08g01880-LOC_Os08g01890 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800542399 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800542399 G A 0.03 0.02 0.0 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800542399 NA 1.22E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 7.74E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 3.73E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 6.50E-11 mr1162 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 5.39E-06 1.05E-13 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 5.00E-06 1.16E-08 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 7.31E-06 mr1327 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 3.90E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 4.45E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 1.03E-12 mr1630 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 9.73E-08 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 7.35E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 3.85E-07 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 1.64E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 2.57E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 9.02E-06 mr1837 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 7.10E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800542399 NA 6.45E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251