Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800504858:

Variant ID: vg0800504858 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 504858
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGATTTATCATCAAATGTTCTTTAAGCATGACATAAGTATTTTTATATTTACATAAAAAATTTGAATAAGACGAATGGTCAAACGTTGATTAAAAAGT[C/T]
AACGGCGTCATACATTAAAATACGGAGGGAGTATAAAATAAGGCACCATATGTAGAAATTAAGAATTTGCACAGGCAAATTATTTCACAACTAGCTACTT

Reverse complement sequence

AAGTAGCTAGTTGTGAAATAATTTGCCTGTGCAAATTCTTAATTTCTACATATGGTGCCTTATTTTATACTCCCTCCGTATTTTAATGTATGACGCCGTT[G/A]
ACTTTTTAATCAACGTTTGACCATTCGTCTTATTCAAATTTTTTATGTAAATATAAAAATACTTATGTCATGCTTAAAGAACATTTGATGATAAATCAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	40.30%	0.11%	0.00%	NA
All Indica	2759	48.80%	51.10%	0.11%	0.00%	NA
All Japonica	1512	83.40%	16.50%	0.07%	0.00%	NA
Aus	269	26.80%	73.20%	0.00%	0.00%	NA
Indica I	595	64.20%	35.60%	0.17%	0.00%	NA
Indica II	465	24.30%	75.50%	0.22%	0.00%	NA
Indica III	913	54.00%	45.90%	0.11%	0.00%	NA
Indica Intermediate	786	45.50%	54.50%	0.00%	0.00%	NA
Temperate Japonica	767	97.10%	2.90%	0.00%	0.00%	NA
Tropical Japonica	504	60.50%	39.30%	0.20%	0.00%	NA
Japonica Intermediate	241	87.60%	12.40%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	7.30%	1.04%	0.00%	NA
Intermediate	90	53.30%	46.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800504858	C -> T	LOC_Os08g01830.1	downstream_gene_variant ; 4837.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800504858	C -> T	LOC_Os08g01830-LOC_Os08g01840	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800504858	NA	1.12E-09	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	1.59E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	7.41E-08	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	7.18E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	5.63E-16	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	9.45E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	9.32E-07	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	7.10E-10	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	6.49E-06	6.79E-07	mr1984	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	1.83E-06	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	1.37E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	1.03E-16	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	1.47E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	2.46E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800504858	NA	1.96E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251